coronavirus

Apollo's Arrow: The Profound and Enduring Impact of Coronavirus on the Way We Live

by Nicholas A. Christakis  · 27 Oct 2020  · 475pp  · 127,389 words

was unfolding. Along with a broad range of scientists, including epidemiologists, virologists, physicians, sociologists, and economists, I turned to Twitter to post tutorial threads on coronavirus-related topics such as the mortality rate in children and the elderly, the reasons we had to “flatten the curve,” the nature of immunity after

…

information, shut down the lab that had done this important work for “rectification.”60 SARS-2 is in the family of viruses knowns as coronaviruses. Some species of coronaviruses cause the common cold in humans; others afflict some of our domesticated animals, like pigs, cats, and chickens. Genetic sequencing showed that

…

due to the cessation of manufacturing activity.87 * * * The emergence of pandemics is not restricted to the twentieth century or to respiratory illnesses caused by coronavirus or influenza, of course. Dramatic outbreaks of infectious diseases have afflicted human beings for a long time. Pathogens are just as important to our species

…

For instance, another survey conducted at the end of April 2020 reported that 67 percent of Americans were “somewhat concerned” or “very concerned” about getting coronavirus themselves. But Americans were even more concerned that their family members would get the virus, with 79 percent expressing this fear.12 Another more clinically

…

time, in another survey conducted after mitigation efforts to flatten the disease curve were well under way, Americans became slightly less fearful of contracting the coronavirus (57 percent were worried in April compared to 51 percent in May), but they became slightly more concerned about severe financial hardship (48 percent

…

of Americans rated as “very important” the following conditions for resuming normal everyday activities at that time: (1) mandatory quarantine for anyone testing positive for coronavirus, (2) improved medical therapies to prevent or treat COVID-19, and (3) significant reduction in the number of new cases or deaths.16 * * * In

…

targeted young and healthy people would be better. But most persuasively, detailed genetic analyses of the pathogen show a pattern of descent from prior bat coronaviruses and of randomly occurring genetic mutations that are not compatible with deliberate genetic engineering.72 However, it is very difficult to totally exclude the possibility

…

organization in Florida calling itself the Genesis II Church of Health and Healing was ordered by a judge to stop selling its “sacramental dosing for coronavirus,” which consisted of a powerful bleaching agent ordinarily used as an industrial chemical.76 The organization described its purported elixir as a “miracle mineral

…

of structural power in the network, dominating the conversation and increasingly winning out against true information.101 * * * The circulation of truth and lies during the coronavirus pandemic was also heightened inadvertently by the increasing use by scientists of a new tool for communication, known as preprint servers, that in some ways

…

carefully vetted (even robust studies are improved significantly by undergoing peer review), and nonexperts usually lack the skills to evaluate its scientific validity. During the coronavirus pandemic, therefore, preprint servers contributed to dissemination of true information but also to what the WHO called an “infodemic” of false information. Online platforms

…

of this pathogen was bad enough without exaggeration of preliminary information making things worse. Another glaring example was an erroneous preprint that claimed that the coronavirus—impossibly—had insertions of genetic material from HIV. By the time scientists had debunked this study, prompting its wholesale withdrawal, it had entered into

…

and those considered blameworthy. Simpleminded Manichaean thinking surges—good versus evil, us versus them. Let’s look at some existing divisions in our society that coronavirus highlights—such as age, sex, race, and socioeconomic status—and then at some new ones it will likely foster. * * * One of the unusual features

…

combinations of gene variants. This variety could result in an immunity advantage compared to the more fixed expression in males.51 * * * Like other infectious diseases, coronavirus strikes differentially along socioeconomic lines. While this pandemic did not cause the structural inequalities in our society, it nevertheless brought them into stark relief. We

…

in the surrounding communities. The pathogen, having brewed at the factories, spread outward.65 * * * Ethnic and racial disparities in the attack rate and CFR of coronavirus also became clear not long after the pandemic struck the United States. The findings typified the usual patterns of differential burden of infectious diseases seen

…

virus vaccines are among the most effective methods of vaccination known, usually conferring very good and long-term immunity. Moderately successful veterinary vaccines for various coronavirus species (used in pigs, cows, cats, and so on) have been of the live attenuated variety, which raises hope for similar success in humans

…

part of their contribution, some scientists attempted to create genetically engineered animals that expressed the human form of the ACE2 protein (the one that the coronavirus latches onto), which would allow still other scientists to more rapidly assess the efficacy of the vaccines they were developing. A whole independent set

…

the opportunity to use our capacities for teaching and learning in order to enhance our survival. * * * One classic study of immunity and symptoms related to coronavirus (involving the 229E strain, which causes the common cold), published in 1990, involved an odd twist.85 Fifteen volunteers were deliberately infected with the virus

…

hope for our modern metropolises. Some of the most densely populated places on earth—Asian cities—have, to date, been very successful in containing the coronavirus pandemic. As we saw before, this paradox illustrates another important feature of our evolutionary heritage: the human capacity for cultural innovation and learning. Modern living

…

).29 Central nervous system symptoms were also more pronounced in that pandemic than is typical of influenza, according to historical accounts, and the OC43 coronavirus is known to be neuro-invasive.30 Another suggestive piece of evidence comes from work that indicates that the Russian flu showed a disproportionate increase

…

shape mortality function, which is unusual for influenza (remember that influenza usually manifests a more pronounced U-shaped function).31 OC43 and a particular bovine coronavirus species show remarkable similarities in their genetic sequences and in the chemical structures of the proteins that elicit an immune response. And by comparison with

…

to an Infectious Disease Hospital, Residents near the Huanan Market Found Infected,” Beijing News, January 2, 2020. 13 Anonymous, “China Detects Large Quantity of Novel Coronavirus at Wuhan Seafood Market,” XinhuaNet, January 27, 2020. 14 J.Q. Gong, “The Whistle-Giver,” People Magazine (China), March 10, 2020. 15 J.X.

…

Provincial People’s Congress Will Be Held on January 12th, 2020,” People’s Daily Online, November 29, 2019; P. Zhuang, “Chinese Laboratory That First Shared Coronavirus Genome with World Ordered Closed for ‘Rectification,’ Hindering Its COVID-19 Research,” South China Morning Post, February 28, 2020. 17 T. Reals, “Chinese Doctor Was

…

of Whistle-Blowing Doctor Li Wenliang,” South China Morning Post, March 19, 2020. 19 C. Buckley, “Chinese Doctor, Silenced After Warning of Outbreak, Dies from Coronavirus,” New York Times, February 6, 2020; Anonymous, “China Identifies 14 Hubei Frontline Workers, Including Li Wenliang, as Martyrs,” Global Times, April 2, 2020. 20

…

. 8 Anonymous, “Hospital Beds (per 1,000 People),” World Bank Data, 2015. 9 L. Frias, “Thousands of Chinese Doctors Volunteered for the Frontline of the Coronavirus Outbreak. They Are Overwhelmed, Under-Equipped, Exhausted, and Even Dying,” Business Insider, February 7, 2020. 10 M. Van Beusekom, “Doctors: COVID-19 Pushing Italian

…

the White House,” Washington Post, April 10, 2020. 63 E. Christakis, The Importance of Being Little, New York: Viking, 2015, p. 136. 64 Anonymous, “Map: Coronavirus and School Closures,” Education Week, March 6, 2020. 65 National Center for Education Statistics, “Digest of Education Statistics: Table 105.20. Enrollment in Elementary, Secondary

…

and Secondary Schools,” U.S. Department of Education Institute of Education Sciences, March 2019. 66 J. Couzin-Frankel, “Does Closing Schools Slow the Spread of Coronavirus? Past Outbreaks Provide Clues,” Science, March 10, 2020. 67 W. Van Lancker and Z. Parolin, “COVID-19, School Closures, and Child Poverty: A Social

…

Measures for Response to an Influenza Pandemic,” Paediatric Respiratory Reviews 2015; 16: 119–126; R.M. Viner et al., “School Closure and Management Practices during Coronavirus Outbreaks Including COVID-19: A Rapid Systematic Review,” Lancet Child & Adolescent Health 2020; 4: 397–404. 69 S. Hsiang, et al., “The Effect of

…

Influenza Pandemic in US Cities,” Proceedings of the National Academy of Sciences 2007; 104: 7588–7593. 74 Anonymous, “School Closures Begin as Japan Steps Up Coronavirus Fight,” Kyodo News, May 2, 2020. 75 S. Kawano and M. Kakehashi, “Substantial Impact of School Closure on the Transmission Dynamics during the Pandemic

…

-Up Service,” Los Angeles Times, April 8, 2020. 2 C. Engelbrecht and C. Kim, “Zoom Shivas and Prayer Hotlines: Ultra-Orthodox Jewish Traditions Upended by Coronavirus,” New York Times, April 16, 2020. 3 N.A. Christakis, Death Foretold: Prophecy and Prognosis in Medical Care, Chicago: University of Chicago Press, 1999;

…

S. Taylor, The Psychology of Pandemics, Newcastle upon Tyne: Cambridge Scholars Publications, 2020. 20 K. King, “Daily Cheers Give Morale Boost to Medical Workers Fighting Coronavirus,” Wall Street Journal, April 18, 2020; A. Mohdin, “Pots, Pans, Passion: Britons Clap Their Support for NHS Workers Again,” The Guardian, April 2, 2020.

…

63 D. Diamond, “Suddenly, Public Health Officials Say Social Justice Matters More Than Social Distance,” Politico, June 4, 2020. 64 M. Bebinger et al., “New Coronavirus Hot Spots Emerge across South and in California, As Northeast Slows,” NPR, June 5, 2020. 65S. Pei et al., “Differential Effects of Intervention Timing on

…

Quaresima, “Warning Letter,” United States Food and Drug Administration, March 6, 2020. 83 K. Rogers, “Trump’s Suggestion That Disinfectants Could Be Used to Treat Coronavirus Prompts Aggressive Pushback,” New York Times, April 24, 2020. 84 L. Wade, “The Secret Life of Vintage Lysol Douche Ads,” Society Pages, September 27, 2013

…

.J. Mercuro et al., “Risk of QT Interval Prolongation Associated with Use of Hydroxychloroquine with or without Concomitant Azithromycin among Hospitalized Patients Testing Positive for Coronavirus Disease 2019 (COVID-19),” JAMA Cardiology, May 1, 2020; J. Yazdany and A.H.J. Kim, “Use of Hydroxychloroquine and Chloroquine during the COVID-

…

Callousness toward AIDS Victims,” New York Times, November 7, 1987. 11 R. Brackett, “Governor Says State Will Accept Florida Residents from Cruise Ship Stricken with Coronavirus,” Weather Channel, April 1, 2020; M. Burke, K. Sanders, “Cruise Ship with Sick Passengers and Sister Ship Dock in Florida,” NBC News, April 3,

…

2020. 12 D. Quan, “‘Dreams Are Not Passports’: Remote Arctic Village Residents Recount Bizarre Encounter with Quebec Couple Fleeing Coronavirus,” The Star [Toronto], March 30, 2020. 13 Procopius, History of the Wars, trans. H.B. Dewing, Cambridge, MA: Harvard University Press, 1914, p. 453.

…

Patients, Later Rescinds Them,” Journal of Emergency Medical Services, April 22, 2020. 46 C. Huang et al., “Clinical Features of Patients Infected with 2019 Novel Coronavirus in Wuhan, China,” The Lancet 2020; 395: 497–506. 47 C.M. Petrilli et al., “Factors Associated with Hospital Admission and Critical Illness among

…

Hormones Regulate Innate Immune Cells and Promote Sex Differences in Respiratory Virus Infection,” Frontiers in Immunology 2018; 9: 1653. 50 P. Conti and A. Younes, “Coronavirus COV-19/SARS-CoV-2 Affects Women Less Than Men: Clinical Response to Viral Infection,” Journal of Biological Regulators and Homeostatic Agents 2020; 34: 32253888

…

on Time to Clinical Improvement in Patients with Severe and Life-Threatening COVID-19: A omized Clinical Trial,” JAMA, June 3, 2020. 63 D. Lowe, “Coronavirus Vaccine Prospects,” Science Translational Medicine, April 15, 2020. 64 D.R. Hopkins, The Greatest Killer: Smallpox in History, with a New Introduction, Chicago: University

…

of Chicago Press, 2002, p. 80. 65 L.J. Saif, “Animal Coronavirus Vaccines: Lessons for SARS,” Developments in Biologicals 2004; 119: 129–140. 66 H. Wang et al., “Development of an Inactivated Vaccine Candidate, BBIBP-CorV, with

…

al., “Development of an Inactivated Vaccine Candidate for SARS-CoV-2,” Science 2020; 369: 77–81; J. Cohen, “Covid-19 Vaccine Protects Monkeys from New Coronavirus, Chinese Biotech Reports,” Science, April 23, 2020. 68 F.C. Zhu et al., “Safety, Tolerability, and Immunogenicity of a Recombinant Adenovirus Type-5 Vectored

…

) for Phase 1 Study,” Moderna, February 24, 2020. 70 Anonymous, “Moderna Announces Positive Interim Phase 1 Data for Its mRNA Vaccine (mRNA-1273) against Novel Coronavirus,” Moderna, May 18, 2020. 71 Anonymous, “Moderna Reports Positive Data from Phase I COVID-19 Vaccine Trial,” Moderna, May 19, 2020. 72 G. Ramon,

…

Development Landscape,” Nature Reviews Drug Discovery 2020; 19: 305–306. 77 K.A. Callow et al., “The Time Course of the Immune Response to Experimental Coronavirus Infection of Man,” Epidemiology and Infection 1990; 105: 435–446; L.P. Wu et al., “Duration of Antibody Responses after Severe Acute Respiratory Syndrome,”

…

a Pandemic: Social Networks and the Macroeconomic Response of Consumption,” SSRN, May 17, 2020. 61 Associated Press, “U.S. Online Alcohol Sales Jump 243% during Coronavirus Pandemic,” MarketWatch, April 2, 2020. 62 W. Oremus, “What Everyone’s Getting Wrong about the Toilet Paper Shortage,” Medium Marker, April 2, 2020. 63

…

. Joseph, “Roll Call: The Importance of Teacher Attendance,” National Council on Teacher Quality, June 2014. 86 G. Viglione, “How Scientific Conferences Will Survive the Coronavirus Shock,” Nature, June 2, 2020. 87 L.B. Kahn, “The Long-Term Labor Market Consequences of Graduating from College in a Bad Economy,” Labour Economics

…

Protocol: Prospective Observational Cohort Study,” British Medical Journal 2020; 369: m1985; Y. Wu et al., “Nervous System Involvement after Infection with COVID-19 and Other Coronaviruses,” Brain, Behavior, and Immunity 2020; 87: 18–22; S.H. Wong et al., “COVID-19 and the Digestive System,” Journal of Gastroenterology and Hepatology

Failures of State: The Inside Story of Britain's Battle With Coronavirus

by Jonathan Calvert and George Arbuthnott  · 18 Mar 2021  · 432pp  · 143,491 words

4, Ireland First published by HarperCollinsPublishers 2021 FIRST EDITION © Jonathan Calvert and George Arbuthnott 2021 Cover design Steve Leard © HarperCollinsPublishers 2021 Sunday Times graphics on coronavirus © The Sunday Times/News Licensing While every effort has been made to trace the owners of copyright material reproduced herein and secure permissions, the publishers

…

-19 world. As investigative reporters for The Sunday Times, we produced a series of articles throughout 2020 examining the UK government’s reaction to the coronavirus crisis and attempting to understand how this country – which prided itself on its pandemic defences – managed to get it so badly wrong. Our first

…

decision – for thousands of people. A study by Imperial College London’s pandemic modellers and Oxford University’s department of statistics has estimated that coronavirus infections across the UK rocketed from an estimated 200,000 to 1.5 million in the nine days before lockdown as the prime minister agonised

…

corona) when viewed under a microscope because of the spikes protruding from their surface. Before Covid-19 appeared in 2019 there were six types of coronavirus known to infect humans, but mostly they caused mild respiratory symptoms with the exception of the Middle East Respiratory Syndrome in 2012 and Sars, which

…

who had spearheaded his country’s efforts to combat the Sars pandemic nine years earlier. Aware the men might be suffering from another Sars-related coronavirus, he advised they be tested for antibodies against Sars, which would have shown whether the men had previously contracted the virus. These tests were

…

more infectious to humans. Papers released by the Wuhan Institute of Virology between 2015 and 2017 describe how Shi’s team combined snippets of different coronaviruses to see if they could be made more transmissible to humans. They called them ‘virus infectivity experiments’. This type of ‘gain-of-function’ work

…

virus] emerged that we found that it was close to Sars-2.’ Other scientists find this indifference to a new strain of a potentially deadly coronavirus hard to believe. Nikolai Petrovsky, Professor of Medicine at Flinders University in Adelaide, South Australia, and secretary-general of the International Immunomics Society, has

…

outcome of the tests inside the market was released later that month, the Chinese state news agency Xinhua reported: ‘The results suggest that the novel coronavirus outbreak is highly relevant to the trading of wild animals.’ However, the picture was far more complicated than it first seemed. An early study

…

spreading rapidly. But in those early days of January, the Chinese scientists did not seek help from international colleagues because the existence of the new coronavirus remained a strict secret. Using a technique to amplify the virus’s genetic material, her team swiftly managed to confirm that samples from five

…

patients at the Wuhan Jinyintan Hospital had genetic sequences present in all coronaviruses. These were sent to a team led by Professor Zhang Yongzhen of the Shanghai Public Health Clinical Centre laboratory, which was able to map

…

has greatly affected the scientists and their research when they should be racing against the clock to find the means to help put the novel coronavirus outbreak under control,’ the source said. The Shanghai Health Commission refused to say what lay behind the decision. Hours after Zhang’s team released

…

, a small band of scientists, academics and enthusiasts from different countries were messaging each other, questioning whether RaTG13 might actually have been the novel coronavirus that Shi had described in her 2016 paper chronicling the results of her team’s sampling in the mine. Despite repeated requests Shi and the

…

of the crisis later unravelled, the public would become increasingly concerned about the committee’s lack of transparency. More information was emerging about the new coronavirus on the day of the first Sage meeting. Chinese scientists were warning that the virus had an unusually high infectivity rate – known as the

…

were allowed to travel across Britain at will. The researchers estimated that up to 1,900 of these passengers would have been infected with the coronavirus – guaranteeing the UK would become a centre of the subsequent pandemic. Sure enough, five days after the Cobra meeting, on Wednesday 29 January, the

…

health secretary having gone on record saying that whistle-blowers in the National Health Service should be protected. Only after the story broke – as the coronavirus was beginning to spread across the world – did Hancock relent to the growing pressure and order an inquiry in early 2020. It raised questions

…

a contract agreeing to accept a 14-day quarantine, which would be spent in hospital accommodation on Merseyside. The following day the WHO declared the coronavirus threat to be a global public health emergency because of the spread of the virus outside of China. It was an ‘unprecedented outbreak’, according

…

the newspaper’s glass London Bridge headquarters and articulated for the first time the shift we were beginning to witness in the media’s attention. ‘Coronavirus is the new Brexit,’ he said. He was correct. The story was only getting bigger and bigger as its catastrophic and devastating ramifications became

…

complacency at the heart of government. Answering questions from MPs, Hancock repeated his message that the NHS had the capacity to treat 50 to 500 coronavirus patients. He was asked by a friendly Conservative colleague, Dr Caroline Johnson MP, whether there were preparations for a wider package of measures – such

…

has since decided to pause implementation of the proposed mobile alerting system,’ it states. The last rehearsal for a pandemic before the emergence of the coronavirus hardly inspired confidence. Run by Public Health England in October 2016, the three-day operation codenamed Cygnus tested how more than 950 officials – including

…

plan had been mothballed around the time the Brexit planning got very intense in 2017.’ It meant that in the years leading up to the coronavirus outbreak, key government committee meetings on pandemic planning were repeatedly ‘bumped’ off the diary to make way for discussions about what were deemed more

…

national pandemic stockpile had been established in 2009 following the swine flu outbreak, with around £500m being spent on protective equipment. By the time the coronavirus pandemic began, the stockpile was mostly housed in a 370,000-square-foot distribution centre in Merseyside that had been built specifically for the purpose

…

’. It concluded ministers had plenty of time and ample warning but had done next to nothing. It said: ‘Despite the first reported case of coronavirus being confirmed by the chief medical officer in England on 31 January 2020, the Treasury did not announce plans for significant funding to support businesses

…

to anticipate looming problems before it was too late’ and expressed his concerns about ‘curtailed cabinet meetings’ where issues such as the economic impact of coronavirus received just five minutes of ‘discussion in January’. It had often been noted by those who worked with Johnson that he had a habit of

…

Tedros Adhanom Ghebreyesus, the World Health Organization director-general, issued a stark warning. He said the opportunity to contain the wider spread of the deadly coronavirus was slipping away. ‘The window of opportunity is narrowing, so we need to act quickly before it closes completely,’ he declared. 6 Part-Time Prime

…

was initially prevalent among younger people in the country’s ski resorts, who were either: asymptomatic; mildly affected; or their illness wasn’t recognised as coronavirus. On the day before the Conservatives’ ball, Italy had been forced to bring in the first control measures, with the country’s sports minister

…

each strain had originated by comparing it to samples taken in other countries. They found that more than 1,000 different people had brought the coronavirus into Britain, which ruled out the idea that one superspreader or ‘patient zero’ sparked the outbreak. Most of the infections in February had indeed

…

a surge in patients needing ventilation to help them breathe. They warned that weaker patients could therefore be denied life-saving care during a severe coronavirus outbreak, with senior consultants being left in the invidious position of having to decide who would be given access to ventilators and beds. Professor

…

an interest in the crisis that was gripping his nation. That morning he summoned Hancock and Whitty into Downing Street to specifically discuss concerns about coronavirus. Eight weeks after reports of the new virus had emerged and after missing all five Cobra meetings on the subject, the prime minister had

…

Monday. In a letter to the European Society of Intensive Care Medicine, they revealed that up to 10 per cent of all those infected with coronavirus in Italy had needed intensive care. This, according to the three authors of the letter – professors Maurizio Cecconi, Antonio Pesenti and Giacomo Grasselli from

…

would not be overwhelmed, as they were in Italy. That day the London Ambulance Service increased the threshold for the severity of symptoms that a coronavirus patient would have to typically exhibit before they would be taken to hospital. This had dangerous consequences. The sense of impatience with the government’

…

that week before lockdown, the health service’s burden was increasing by a third. The complacency that had allowed Johnson to sail through February believing coronavirus to be a medically ‘irrational panic’ was rapidly dissipating. His government was panicking and nothing showed this more clearly than the chancellor Rishi Sunak’s

…

a bad example. And they were also endangering lives. In times of extremis, extraordinary things happen with hardly anyone batting an eyelid. That day the Coronavirus Act – the most authoritarian new law since the Second World War, which set out the legal basis for lockdown – raced through parliament with little

…

were forced to deploy the tool or a version of it. They had been faced with an impossible situation with far too many severely ill coronavirus patients requiring intensive care when there were insufficient beds or staff available. The government-commissioned age-based ‘triage tool’ was the only guidance they

…

place in hospital had been displaced to people’s homes and the care homes. This huge increase in deaths outside hospitals was a mixture of coronavirus cases – many of which were never diagnosed – and people who were not given treatment for other conditions that they would normally have received had

…

were dispatched from hospitals into care homes that were completely open to infection and then cross-infection. A third of all care homes declared a coronavirus outbreak, with more than a thousand dealing with positive cases during the peak of infections in April, according to the National Audit Office. Chris

…

least in part, because of his stubborn libertarianism.’ And the criticism went on. Greece’s progressive daily newspaper Ethnos described Johnson as ‘more dangerous than coronavirus’, saying one of the crisis’s greatest tragedies was that ‘incompetent leaders’ such as Johnson and Donald Trump were ‘at the helm at a

…

another outbreak in Westminster and disenfranchising vulnerable MPs. The logistics of observing the two-metre social distancing rule in the Commons while voting created a ‘coronavirus conga’ in which 523 politicians had to form a queue stretching for hundreds of metres. The queue snaked across the courtyards of the Palace

…

room’, while Labour MP Geraint Davies told the Guardian: ‘This is wholly irresponsible publicity by the Conservative government, which will fuel a resurgence of coronavirus infection and death in England.’1 The Treasury quickly backed down and removed the tweet, admitting it had ‘got it wrong’. The NHS high command

…

was ‘creating population immunity’. During the interview, he called on the prime minister to subtly change his language to ‘normalise’ the September rise in coronavirus cases, arguing that it was usual for respiratory-type infections to multiply around that time of year. ‘This is a seasonal effect now, and if

…

Radio 4’s Today programme: ‘The government has consistently throughout this year been ahead of the curve in terms of proactive measures with regards to coronavirus.’ Johnson claimed sarcastically that the criticisms against him amounted to people being wise after the event, when he appeared on BBC One’s Andrew

…

Reuters, 24 May 2011. 4: Sleepwalk 1. ‘Revealed: NHS denied PPE at height of Covid-19 as supplier prioritised China’, Guardian, 20 July 2020. 2. ‘Coronavirus: Did the government get it wrong?’, Dispatches, Channel 4, 3 June 2020. 3. Ibid. 4. ‘Revealed: Value of UK pandemic stockpile fell by 40% in

…

s home’, Guardian, 21 June 2019. 9. ‘Charlotte Edwardes on Boris Johnson’s wandering hands’, The Sunday Times, 29 September 2019. 10. ‘Hospitals prepare for coronavirus epidemic to sweep Britain’, The Sunday Times, 16 February 2020. 11. ‘The prime minister’s vanishing briefs’, The Sunday Times, 23 February 2020. 12. ‘Where

…

February 2020. 7: The Action Plan 1. ‘UK has plans to deal with pandemic causing up to 315,000 deaths’, Guardian, 6 March 2020. 2. ‘Coronavirus: Did the government get it wrong?’, Dispatches, Channel 4, 3 June 2020. 3. Ibid. 8: Herd Immunity 1. ‘Boris Johnson heckled during visit to

…

Covid-19 doing well’, Guardian, 16 April 2020. 3. ‘From evasion to evisceration: How the Cummings lockdown story unfolded’, Guardian, 29 May 2020. 4. ‘Coronavirus: More than 4,000 hospital patients discharged into care homes without test’, Sky News, 17 July 2020. 5. ‘Three nurses forced to wear bin bags

…

22 May 2020. 5. ‘New witnesses cast doubt on Dominic Cummings’s lockdown claims’, Guardian, 23 May 2020. 6. ‘Chief nurse dropped from Downing Street coronavirus briefing “after refusing to back Dominic Cummings”’, Independent, 12 June 2020. 7. ‘Serious weaknesses in the UK’s current plans for suppressing covid-19 risk

…

, 403 Academy of Medical Sciences 237, 336, 338, 353 action plan, UK government (‘contain, delay, research, mitigate’ strategy) 152–66 All-Party Parliamentary Group on Coronavirus 396, 398 ambulance service 95, 190, 224, 237, 243, 247, 264, 265–7, 268, 269, 270, 273, 274–5, 282, 294, 290, 291, 392,

…

203, 401; lockdown and 296, 302, 319, 322, 329, 339, 340, 359 Conte, Giuseppe 192–3 Corbyn, Jeremy 76, 127, 137, 138, 240 Coronavirus Act (2020) 226–7 Coronavirus Clinical Characterisation Consortium 396 Cosford, Paul 64, 109 Costello, Anthony 181, 369 Covid-19 (Sars-CoV-2): asymptomatic spread of 135, 142, 144

Aftershocks: Pandemic Politics and the End of the Old International Order

by Colin Kahl and Thomas Wright  · 23 Aug 2021  · 652pp  · 172,428 words

News, May 30, 2020, https://www.nbcnews.com/politics/donald-trump/trump-says-he-postponing-g7-summit-n1219896.     4.  Johns Hopkins University & Medicine, Coronavirus Research Center, https://coronavirus.jhu.edu/; International Monetary Fund, “Transcript of the World Economic Outlook Press Briefing,” January 26, 2021, https://www.imf.org/en/News/Articles/

…

-briefing.     5.  “United States: Cumulative Confirmed Deaths: How Do They Compare to Other Countries?” Our World in Data, accessed March 30, 2021, https://ourworldindata.org/coronavirus/country/united-states.     6.  Colin H. Kahl, States, Scarcity, and Civil Strife in the Developing World (Princeton, NJ: Princeton University Press, 2006).     7.  Thomas

…

.com/articles/world/2020-06-09/when-system-fails.     5.  COVID-19 Dashboard, Center for Systems Science and Engineering, Johns Hopkins University & Medicine, Coronavirus Resource Center, https://coronavirus.jhu.edu/map.html, accessed May 5, 2021.     6.  Walter Scheidel, “The Spanish Flu Didn’t Wreck the Global Economy,” Foreign Affairs, May

…

Osterholm and Mark Olshaker, “Chronicle of a Pandemic Foretold,” Foreign Affairs, July/August 2020, 19, https://www.foreignaffairs.com/articles/united-states/2020-05-21/coronavirus-chronicle-pandemic-foretold.   12.  Mapping the Global Future: Report of the National Intelligence Council’s 2020 Project (Washington, DC: National Intelligence Council, 2004), 9–

…

.   30.  World Health Organization, transcript, “Virtual Press Conference on COVID-19,” March 11, 2020, 14, https://www.who.int/docs/default-source/coronaviruse/transcripts/who-audio-emergencies-coronavirus-press-conference-full-and-final-11mar2020.pdf?sfvrsn=cb432bb3_2.   31.  Interview with David Fidler, March 8, 2021.   32.  Xiaolin Wei, “China’s

…

David Bandurski, “Whistling Against Deception,” China Media Project, March 11, 2020, http://chinamediaproject.org/2020/03/11/whistling-against-deception/.   43.  Whittell, “The Disappeared.”   44.  “Coronavirus: Why Have Two Reporters in Wuhan Disappeared?,” BBC, February 14, 2020, https://www.bbc.com/news/world-asia-china-51486106.   45.  Bill Bishop, “Another Standing

…

Exclusive: Internal Chinese Report Warns Beijing Faces Tiananmen-Like Global Backlash over Virus—Sources,” Reuters, May 4, 2020, https://uk.reuters.com/article/uk-health-coronavirus-china-sentiment-ex/exclusive-internal-chinese-report-warns-beijing-faces-tiananmen-like-global-backlash-over-virus-sources-idUKKBN22G198.   75.  China Global Television Network, “Zhong Nanshan

…

: With Covid, China Took a Leading Role,” Associated Press, February 15, 2021, https://apnews.com/article/pandemics-beijing-only-on-ap-epidemics-media-122b73e134b780919cc1808f3f6f16e8.   82.  “Coronavirus: China Accuses US of Spreading ‘Conspiracies,’” BBC, May 24, 2020, https://www.bbc.com/news/world-asia-china-52790634.   83.  Hua Chunying 华春莹 (@SpokespersonCHN), “#Pompeo

…

, Laura Kayali, and Laurens Cerulus, “European Commission Accuses China of Peddling Disinformation,” Politico, June 10, 2020, https://www.politico.eu/article/european-commission-disinformation-china-coronavirus/.   92.  Yang, “China’s Early Warning System.”   93.  Whittell, “The Disappeared.”   94.  Yao Yang, “Is a New Cold War Coming?,” interview with Beijing Cultural

…

_beyond_the_pandemic.   15.  Maurizio Massari, “Italian Ambassador to the EU: Italy Needs Europe’s Help,” Politico, March 10, 2020, https://www.politico.eu/article/coronavirus-italy-needs-europe-help/.   16.  Europe Elects (@EuropeElects), “Italy: Tecnè poll,” Twitter, April 11, 2020, 5:00 p.m., https://twitter.com/europeelects/status

…

,” Financial Times, April 16, 2020, https://www.ft.com/content/3ea8d790-7fd1-11ea-8fdb-7ec06edeef84.   32.  Schmitt-Roschmann, “After Glimpsing ‘Abyss’”; Rinke and Wacket, “Coronavirus Pandemic Is Historical Test”; Sánchez, “Europe’s Future Is at Stake”; Mallet and Khalaf, “FT Interview: Emmanuel Macron.”   33.  Martin Wolf, “German Court Decides to

…

Lee, “Taiwan’s New ‘Electronic Fence’ for Quarantines Leads Wave of Virus Monitoring,” Reuters, March 20, 2020, https://www.reuters.com/article/us-health-coronavirus-taiwan-surveillanc/taiwans-new-electronic-fence-for-quarantines-leads-wave-of-virus-monitoring-idUSKBN2170SK; interviews with government officials of Taiwan.   40.  “Taiwan Can Help, and

…

/; Rocky Swift, “Study Links Japan’s Domestic Travel Campaign to Increased COVID-19 Symptoms,” Reuters, December 8, 2020, https://www.reuters.com/article/health-coronavirus-japan-travel/study-links-japans-domestic-travel-campaign-to-increased-covid-19-symptoms-idUSKBN28I17C; Sho Saito, Yusuke Asai, and Nobuaki Matsunaga, “First and Second COVID

…

-3/fulltext; Bloomberg Quicktake (@Quicktake), “WATCH: Thousands of people in Brazil banged pots from their balconies in protest against President Bolsonaro’s handling of the #coronavirus pandemic,” Twitter, March 19, 2020, 10:00 p.m., https://twitter.com/QuickTake/status/1240820403435700226?s=20.   54.  Antonia Noori Farzan and Miriam Berger,

…

  77.  Vanessa Molter, “Virality Project (China): Pandemics & Propaganda,” Stanford Cyber Policy Center, March 19, 2020, https://cyber.fsi.stanford.edu/news/chinese-state-media-shapes-coronavirus-convo; Rachel Kleinfeld, “Do Authoritarian or Democratic Countries Handle Pandemics Better?,” Carnegie Endowment for International Peace, March 31, 2020, https://carnegieendowment.org/2020/03/31

…

Sawyer Crosby, and Samantha Kiernan, “Fighting a Pandemic Requires Trust,” Foreign Affairs, October 23, 2020, https://www.foreignaffairs.com/articles/united-states/2020-10-23/coronavirus-fighting-requires-trust.   80.  Migone, “The Influence of National Policy Characteristics”; “The Politics of Pandemics: Why Some Countries Respond Better Than Others,” Knowledge@Wharton, May

…

=premium&sref=bxQtWDnd.   19.  Author interview with three European Central Bank officials, February 12, 2021.   20.  Randow and Skolimowski, “Christine Lagarde’s $810 Billion Coronavirus U-Turn.”   21.  “Interview with Christine Lagarde, President of the ECB, Conducted by Matthieu Pelloli and Published on 9 April 2020,” European Central Bank, April

…

com/content/f8efe708-3c22-493b-88bd-855ec6d98522; Danica Kirka, “UK Economy Suffers Biggest Drop Since 1709,” Associated Press, February 12, 2021, https://apnews.com/article/coronavirus-pandemic-economy-4f0b6285a57c8b2929e2aceb864e7675; Prinesha Naidoo, “S. Africa Virus-Hit Economy Shrank Most in 100 Years in 2020,” Bloomberg, March 9, 2021, https://www.bloomberg.com

…

Student Enrollment Snapshot,” Institute of International Education, November 2020, https://www.iie.org/Research-and-Insights/Open-Doors/Fall-International-Enrollments-Snapshot-Reports; Peter Hurley, “Coronavirus and International Students,” Mitchell Institute at Victoria University, October 2020, https://www.vu.edu.au/sites/default/files/international-student-update-2020-mitchell-institute.pdf

…

-bangladeshs-garment-industry/a-53895339.     2.  Quoted in Rebecca Wright and Salman Saeed, “Bangladeshi Garment Workers Face Ruin as Global Brands Ditch Clothing Contracts amid Coronavirus Pandemic,” CNN Business, April 22, 2020, https://www.cnn.com/2020/04/22/business/bangladesh-garment-factories/index.html.     3.  “Dhaka, Bangladesh Population,” Population

…

Paul, “Bangladesh Shuts Down Villages After Tens of Thousands Attend Cleric’s Funeral,” Reuters, April 20, 2020, https://www.reuters.com/article/us-health-coronavirus-bangladesh/bangladesh-shuts-down-villages-after-tens-of-thousands-attend-clerics-funeral-idUSKBN2220PA.     9.  Kamran Reza Chowdhury, “COVID-19 Cases Soar in Bangladesh; Thousands Defy

…

2020.   12.  Ruma Paul, “Garment Exporter Bangladesh Faces $6 Billion Hit as Top Retailers Cancel,” Reuters, March 31, 2020, https://www.reuters.com/article/health-coronavirus-bangladesh-exports/garment-exporter-bangladesh-faces-6-billion-hit-as-top-retailers-cancel-idUKKBN21I2R9.   13.  “Helping Bangladesh Recover from COVID-19,” International Monetary Fund, June

…

11/bangladesh-to-resume-international-flights-on-june-16.   33.  COVID-19 Dashboard, Center for Systems Science and Engineering, Johns Hopkins University & Medicine, Coronavirus Resource Center, https://coronavirus.jhu.edu/map.html, accessed December 26, 2020.   34.  Shaina Ahluwalia and Anurag Maan, “South Asia Reached 10 Million COVID-19 Cases—Reuters

…

imf.org/en/Publications/WEO/%20Issues/2021/01/26/2021-world-economic-outlook-update.   98.  Claudia Viale, “Peru: Updated Assessment of the Impact of the Coronavirus Pandemic on the Extractive Sector and Resource Governance,” Natural Resource Governance Institute, December 18, 2020, https://resourcegovernance.org/analysis-tools/publications/peru-updated-assessment-impact

…

Surge Among Refugees in Middle East as Pandemic Pushes Most Vulnerable Deeper into Poverty,” Independent, September 20, 2020, https://www.independent.co.uk/independentpremium/world/coronavirus-cases-surge-among-refugees-middle-east-pandemic-pushes-most-vulnerable-deeper-poverty-b506833.html.   93.  Dempster et al., “Locked Down and Left Behind.”   94

…

Berger, “Refugee Camps Have Avoided the Worst of the Pandemic.”   96.  Quoted in Raquel Carvalho, “Rohingya Refugees in Bangladesh Struggle with Fear and Stigma amid Coronavirus,” South China Morning Post, September 13, 2020, https://www.scmp.com/week-asia/health-environment/article/3101271/rohingya-refugees-bangladesh-struggle-fear-and-stigma.   

…

, “Protesters Paralyze Bolivia over Election Delays, Threaten Escalation,” Washington Post, August 12, 2020, https://www.washingtonpost.com/world/the_americas/bolivia-protest-blockade-anez-evo-coronavirus/2020/08/11/7ffceb50-db48-11ea-809e-b8be57ba616e_story.html.   24.  Trigo, Kurmanaev, and McCann, “As Politicians Clashed, Bolivia’s Pandemic Death Rate Soared.”   

…

deploys-drones-cameras-loudhailers-chastise-people/story?id=68746989; Yujing Liu, “China Adapts Surveying, Mapping, Delivery Drones to Enforce World’s Biggest Quarantine and Contain Coronavirus Outbreak,” South China Morning Post, March 5, 2020, https://www.scmp.com/business/china-business/article/3064986/china-adapts-surveying-mapping-delivery-drones-task.   

…

Enforce the Country’s Lockdown After the Mayor Worried Residents Weren’t Taking Containment Measures Seriously,” Business Insider, March 20, 2020, https://www.businessinsider.com/coronavirus-drones-france-covid-19-epidemic-pandemic-outbreak-virus-containment-2020-3; Helene Fouquet and Gaspard Sebag, “French Covid-19 Drones Grounded After Privacy Complaint,” Bloomberg

…

.wsj.com/articles/beijing-ousts-four-opposition-lawmakers-in-hong-kong-11605080352; Repucci and Slipowitz, Democracy Under Lockdown, 10.   57.  Faiola, Wessel, and Mahtani, “Coronavirus Chills Protests”; Chenoweth et al., “The Global Pandemic Has Spawned New Forms of Activism—and They’re Flourishing.”   58.  Charis McGowan, “How Quarantined Chileans Are

…

-and-economic-trends-in-urban-suburban-and-rural-communities/; Elise Gould and Valerie Wilson, “Black Workers Face Two of the Most Lethal Preexisting Conditions for Coronavirus—Racism and Economic Inequality,” Economic Policy Institute, 2020, https://www.epi.org/publication/black-workers-covid/; Emily Benfer and Lindsay Wiley, “Health Justice Strategies

…

; Brenda Goodman, “Where Do COVID Vaccines Stand Against the Variants?,” Medscape, March 29, 2021, https://www.medscape.com/viewarticle/948335.     8.  Corum and Zimmer, “Coronavirus Variants and Mutations.”     9.  “Total Confirmed Cases of COVID-19,” Our World in Data, accessed February 17, 2021, https://ourworldindata.org/grapher/cumulative-covid-cases

…

Mid-June,” Politico, May 13, 2020, https://www.politico.eu/article/germany-eases-border-checks-but-some-restrictions-will-remain-until-mid-june-coronavirus-covid19/.   14.  European Commission, “Coronavirus: Commission Recommends Partial and Gradual Lifting of Travel Restrictions to the EU After 30 June, Based on Common Coordinated Approach,” press release,

…

-security-financing/.   61.  Jillian Deutsch and Sarah Wheaton, “How Europe Fell Behind on Vaccines,” Politico, January 27, 2021, https://www.politico.eu/article/europe-coronavirus-vaccine-struggle-pfizer-biontech-astrazeneca/.   62.  Deutsch and Wheaton, “How Europe Fell Behind on Vaccines”; Jacob Funk Kirkegaard, “The European Union’s Troubled COVID-19

…

to Limit Vaccine Exports.”   72.  Rym Momtaz, “Macron: AstraZeneca Vaccine Seems ‘Quasi-Ineffective’ on Older People,” Politico, January 29, 2021, https://www.politico.eu/article/coronavirus-vaccine-europe-astrazeneca-macron-quasi-ineffective-older-pe/.   73.  European Medicines Agency, “EMA Recommends COVID-19 Vaccine AstraZeneca for Authorisation in the EU,” January 29

…

, 2020, https://www.washingtonpost.com/world/vaccine-russia-china-influence/2020/11/23/b93daaca-25e5-11eb-9c4a-0dc6242c4814_story.html; Mark Scott, “In Race for Coronavirus Vaccine, Russia Turns to Disinformation,” Politico, November 19, 2020, https://www.politico.eu/article/covid-vaccine-disinformation-russia/; Lili Bayer and Jillian Deutsch, “Hungary

…

March 27, 2021, https://www.nytimes.com/2021/03/27/world/americas/virus-brazil-bolsonaro.html.   89.  Quoted in Mauricio Savarese, “Brazil’s Bolsonaro Rejects Coronavirus Vaccine from China,” AP News, October 21, 2020, https://apnews.com/article/virus-outbreak-brazil-state-governments-health-sao-paulo-b7b5b620ba54f402dbf803e26fe6b842.   90.  Antonia Noori Farzan

…

and Heloísa Traiano, “U.S. Officials Pushed Brazil to Reject Russia’s Coronavirus Vaccine, According to HHS report,” Washington Post, March 16, 2021, https://www.washingtonpost.com/world/2021/03/16/hhs-brazil-sputnik-russia/.   91.  Eduardo

…

Macaya, Melissa Mathani, and Fernando Alfonso III, “October 2: Trump’s Covid Diagnosis,” CNN, October 2, 2020, https://www.cnn.com/politics/live-news/trump-coronavirus-positive/h_cebb891fe9fe8513948709d5f1793e07.   95.  Jeff Mason and Joseph Ax, “Chaotic Clash in Cleveland: Five Takeaways from First U.S. Presidential Debate,” Reuters, September 29,

…

-international-health-architecture; “U.S., China Positive on Pandemic Treaty Idea: WHO’s Tedros,” Reuters, March 30, 2021, https://www.reuters.com/article/us-health-coronavirus-treaty-members-idUSKBN2BM10T.   35.  Burwell et al., “Improving Pandemic Preparedness: Lessons from COVID-19,” 78–79, 89–92.   36.  World Health Organization, “International Health

…

Adhanom Ghebreyesus third wave (of autocratization) Tillerson, Rex Tooze, Adam Troye, Olivia Trump, Donald “America First” platform Bolsonaro, Jair, and cancellation of 2020 G7 summit Coronavirus Task Force COVID-19 response COVID-19 vaccine development and on “deep state” downplaying of COVID-19 Helsinki summit Johnson, Boris, and Macron, Emmanuel, and

The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race

by Walter Isaacson  · 9 Mar 2021  · 700pp  · 160,604 words

the Middle Ages, by repeated viral epidemics. Always prepared and methodical, Doudna (pronounced DOWD-nuh) presented slides that suggested ways they might take on the coronavirus. She led by listening. Although she had become a science celebrity, people felt comfortable engaging with her. She had mastered the art of being tightly

…

acid (RNA) and a similar molecule that lacks one oxygen atom and thus is called deoxyribonucleic acid (DNA). From an evolutionary perspective, both the simplest coronavirus and the most complex human are essentially protein-wrapped packages that contain and seek to replicate the genetic material encoded by their nucleic acids. The

…

the understanding of how little strands of RNA behaved would become increasingly important, both to the field of gene editing and to the fight against coronaviruses. * * * As a young PhD student, Doudna mastered the special combination of skills that distinguished Szostak and other great scientists: she was good at doing

…

a field that would become unexpectedly relevant later in her career: viruses. Specifically, she was interested in how the RNA in some viruses, such as coronaviruses, allow them to hijack the protein-making machinery of cells. During her first semester at Berkeley, in the fall of 2002, there was an

…

. The hope then was that drugs based on RNA interference might someday be a good option for treating severe viral infections, including those from new coronaviruses.7 * * * Doudna’s paper on RNA interference appeared in Science in January 2006. A few months later, a paper published in a little-known

…

pursued an oddity of nature out of pure curiosity, and that seeded the ground for applied technologies such as gene editing and tools to fight coronaviruses. However, as with the transistor, it was not simply a one-way linear progression. Instead, there was an iterative dance among basic scientists, practical

…

her proposal to the foundation. It was a prelude to the funding Doudna would receive from Gates in 2020 to use CRISPR systems to detect coronaviruses.7 CHAPTER 16 Emmanuelle Charpentier The wanderer Conferences can have consequences. While attending one in Puerto Rico in the spring of 2011, Doudna had

…

super-high cholesterol, and male pattern baldness.14 In March of that year, however, most academic research labs were temporarily shut down because of the coronavirus pandemic. An exception was made for labs that were engaged in fighting the virus. Many CRISPR researchers, Doudna foremost among them, would shift their focus

…

commanding MIT biology professor named David Baltimore, who that year would win the Nobel Prize for his work showing that viruses containing RNA, such as coronaviruses, can insert their genetic material into the DNA of a host cell through a process known as “reverse transcription.” In other words, the RNA

…

to fix such traits cross the line from health treatment to enhancement? What about genetic modifications that help prevent a person from getting HIV or coronavirus or cancer or Alzheimer’s? Perhaps for these we need a third category called “preventions” in addition to the ill-defined “treatments” and “enhancements.”

…

is reproductive fitness—what traits might cause an organism to reproduce more—which means it permits, and perhaps even encourages, all sorts of plagues, including coronaviruses and cancers, that afflict an organism once its childbearing use is over. This does not mean that, out of respect for nature, we should quit

…

searching for ways to fight against coronaviruses and cancer.16 * * * There is, however, a more profound argument against playing God, best articulated by the Harvard philosopher Michael Sandel. If we humans

…

us would regard Alzheimer’s or Huntington’s to be a result of giftedness. When we create chemotherapies to fight cancer or vaccines to fight coronaviruses or gene-editing tools to fight birth defects, we are, quite properly, exercising mastery over nature rather than accepting the unbidden as a gift.

…

be used by humans to detect and destroy viruses. More important, she had become a maestro of collaboration. It became clear to her that battling coronavirus would require putting together teams that spanned many specialties. Fortunately, she had a base from which she could build such an effort. She had

…

DNA. The viral sequence provides the code for making a mere twenty-nine proteins.4 Here is a sample snippet of the letters in the coronavirus’s RNA: CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC. That sequence is part of a string that codes for making a protein that sits on the outside of the virus shell

…

have been frozen in a liquid, structural biologists were able to create a precise model, atom by atom and twist by twist, of the coronavirus and its spikes. With the sequencing information and structural data in hand, molecular biologists began racing to find treatments and vaccines that would block the

…

sending out group emails, arranging Zoom meetings, and coordinating equipment.” Berkeley’s legal team came up with a policy for sharing discoveries freely with other coronavirus researchers while protecting the underlying intellectual property. At one of the first meetings, a university lawyer laid out a template for royalty-free licensing. “We

…

Hockemeyer watches CHAPTER 49 Testing America’s failure The first official guidance to local health officials in the U.S. about testing for the new coronavirus came in a conference call on January 15, 2020, led by Stephen Lindstrom, a microbiologist at the Centers for Disease Control (CDC). The CDC

…

Secretary Alex Azar, whose department oversees the FDA, declared a public health emergency. The declaration gave the FDA the right to speed up approvals for coronavirus tests. But it had a weird unintended consequence. In normal circumstances, hospitals and university labs can devise their own tests to use at their facilities

…

volunteer army When Doudna and her colleagues at Berkeley’s Innovative Genomics Institute decided at their March 13 meeting to focus on building their own coronavirus testing lab, there was a discussion about what technology to use. Should it be the cumbersome but reliable process of amplifying the genetic material

…

conference, Doudna watched proudly when Hamilton presented her research on using virus-like particles to deliver CRISPR-Cas9 gene-editing tools into humans. When the coronavirus crisis hit in early March, Hamilton told Doudna that she wanted to get involved like people at her University of Washington alma mater were. So

…

Zhang with Patrick Hsu CHAPTER 51 Mammoth and Sherlock CRISPR as a detection tool At the March 13 meeting that Doudna convened to address the coronavirus, she decided that a top priority was to create a high-speed conventional PCR testing lab. But during the discussion, Fyodor Urnov suggested that

…

they also consider a more innovative idea: using CRISPR to detect the RNA of the coronavirus, similar to how bacteria use CRISPR to detect attacking viruses. “There’s a paper that just came out on that,” a participant interjected. Urnov

…

“Check out the resource provided by Mammoth,” he tweeted, including a link to its white paper. “Glad that scientists are working together and sharing openly. #coronavirus.” That tweet reflected a welcome new trend in the CRISPR world. The passionate competition for patents and prizes had led to secrecy about research and

…

the formation of competing CRISPR companies. But the urgency that Doudna and Zhang and their colleagues felt about defeating the coronavirus pushed them to be more open and willing to share their work. Competition was still an important, and useful, part of the equation. There

…

genetically reengineered a safe virus—an adenovirus that causes flu in chimpanzees—by editing into it the gene to make the spike protein of the coronavirus. Similar vaccines developed by other companies in 2020 used a human version of the adenovirus. The vaccine created by Johnson & Johnson, for example, used

…

why this technique is unpopular, especially with those on the receiving end. * * * One of the teams that Doudna organized at the beginning of the coronavirus crisis in March 2020 focused on these delivery challenges facing DNA vaccines. It was led by her former student Ross Wilson, who now runs his

…

BioNTech launched what they dubbed Project Lightspeed to devise a vaccine based on RNA sequences that would cause human cells to make versions of the coronavirus’s spike protein. Once it looked promising, Şahin called Kathrin Jansen, the head of vaccine research and development at Pfizer. The two companies had

…

blood in September, streaming it live on the internet for everyone to watch, Zayner found evidence that he had developed neutralizing antibodies to fight the coronavirus. He called it a “mild success,” but noted that biology often produces murky results. It gave him a greater appreciation for careful clinical trials.

…

Cameron Myhrvold CHAPTER 54 CRISPR Cures The development of vaccines—both the conventional sort and those employing RNA—would eventually help to beat back the coronavirus pandemic. But they are not a perfect solution. They rely on stimulating a person’s immune system, always a risky thing to do. (Most

…

we could actually deliver on quickly.” In the West Coast orbit of Jennifer Doudna, however, there was a team that was pushing forward with a coronavirus treatment. Similar to the CARVER system that Myhrvold had invented, it would use CRISPR to seek and destroy viruses. Stanley Qi and PAC-MAN

…

. People use these regularly to prepare the lung to be less allergic if they are exposed to something.” The same could be done during a coronavirus pandemic; people could use a nasal spray so that PAC-MAN or another CRISPR-Cas13 prophylactic treatment will protect them. * * * Once the delivery mechanisms

…

, we are a social animal, an instinct that cannot fully be satisfied online. Nevertheless, there will be an upside to the fact that the coronavirus has expanded how we work together and share ideas. By hastening the Age of Zoom, the pandemic will broaden the horizons of scientific collaboration, allowing

…

practical applications. CRISPR and COVID are speeding our entry into a life-science era. Molecules are becoming the new microchips. At the height of the coronavirus crisis, Doudna was asked to write a piece for The Economist on the social transformations being wrought. “Like many other aspects of life these

…

not have coalesced so quickly if they had to worry about intellectual property arrangements. Likewise, scientists around the world contributed to an open database of coronavirus sequences that, by the end of August 2020, had thirty-six thousand entries.4 The sense of urgency about COVID also brushed back the gatekeeper

…

process of building on each new finding and allowed the public to follow the advance of science as it happened. On some important papers involving coronavirus, publication on the reprint servers led to crowdsourced vetting and wisdom from experts around the world.5 George Church says he had long wondered

…

be cross-disciplinary, breaking down academic silos and the walls between labs, which have traditionally been independent fiefdoms that fiercely guard their autonomy. Fighting the coronavirus required collaboration across disciplines. In that way, it resembled the effort to develop CRISPR, which involved microbe-hunters working with geneticists, structural biologists, biochemists,

…

. 3. Author’s interviews with Dave Savage, Gavin Knott, and Jennifer Doudna. 4. Jonathan Corum and Carl Zimmer, “Bad News Wrapped in Protein: Inside the Coronavirus Genome,” New York Times, Apr. 3, 2020; GenBank, National Institutes of Health, SARS-CoV-2 Sequences, updated Apr. 14, 2020. 5. Alexander Walls… David

…

30, 2019; Daniel Chertow, “Next-Generation Diagnostics with CRISPR,” Science, Apr. 27, 2018; Ann Gronowski “Who or What Is SHERLOCK?,” EJIFCC, Nov. 2018. Chapter 52: Coronavirus Tests 1. Author’s interviews with Feng Zhang. 2. Feng Zhang, Omar Abudayyeh, and Jonathan Gootenberg, “A Protocol for Detection of COVID-19 Using CRISPR

…

Diagnostics,” Broad Institute website, posted Feb. 14, 2020; Carl Zimmer, “With Crispr, a Possible Quick Test for the Coronavirus,” New York Times, May 5, 2020. 3. Goldberg, “CRISPR Comes to COVID”; “Sherlock Biosciences and Binx Health Announce Global Partnership to Develop First CRISPR-Based

…

COVID-19 Outbreak,” Biocentury, Feb. 28, 2020. 5. James Broughton… Charles Chiu, Janice Chen, et al., “A Protocol for Rapid Detection of the 2019 Novel Coronavirus SARS-CoV-2 Using CRISPR Diagnostics: SARS-CoV-2 DETECTR,” Mammoth Biosciences website, posted Feb. 15, 2020. The full Mammoth paper with patient data and

…

CoV-2,” Nature Biotechnology, Apr. 16, 2020 (received Mar. 5, 2020). See also Eelke Brandsma… and Emile van den Akker, “Rapid, Sensitive and Specific SARS Coronavirus-2 Detection: A Multi-center Comparison between Standard qRT-PCR and CRISPR Based DETECTR,” medRxiv, July 27, 2020. 6. Julia Joung… Jonathan S. Gootenberg, Omar

…

31, 2020. 14. Sharon LaFraniere, Katie Thomas, Noah Weiland, David Gelles, Sheryl Gay Stolberg and Denise Grady, “Politics, Science and the Remarkable Race for a Coronavirus Vaccine,” New York Times, Nov. 21, 2020; author’s interviews with Noubar Afeyan, Moncef Slaoui, Philip Dormitzer, Christine Heenan. Chapter 54: CRISPR Cures 1. David

…

s Next Virus Killer?,” Wired, Mar. 10, 2020. 16. Timothy Abbott… and Lei [Stanley] Qi, “Development of CRISPR as a Prophylactic Strategy to Combat Novel Coronavirus and Influenza,” bioRxiv, Mar. 14, 2020. 17. Author’s interview with Stanley Qi. 18. IGI weekly Zoom meeting, Mar. 22, 2020; author’s interviews with

…

starter cultures and, xviii, 90–92, 133, 143 CRISPR applications, 243–63 affordability of, 247–48 biohacking, 253–57, 263, 285, 288, 443–44 coronavirus testing, 413, 417 cures for viral infections, 449–57 CARVER, 452–53, 455–57 PAC-MAN, 454–57, 460 defense against terrorists, 259–63 diagnostic

…

, 107–8 fluorescent proteins, 165–67, 382–83 flytrap plants, 171 FokI enzyme, 155 Fonfara, Ines, 137 Food and Drug Administration (FDA), 294, 363, 446 coronavirus tests and, 407–10 Foy, Shaun, 205–7 Frangoul, Haydar, 244 Frankenstein (Shelley), 267, 269, 283, 286, 297 Franklin, Benjamin, 479 Franklin, Rosalind, 21–

…

Jacket montage by Debra Lill Jacket photograph of Jennifer Doudna by Brad Torchia/August Image (The letters are part of the RNA code of the coronavirus that causes COVID.) Library of Congress Cataloging-in-Publication Data Names: Isaacson, Walter, author.Title: The code breaker : Jennifer Doudna, gene editing, and the

Shutdown: How COVID Shook the World's Economy

by Adam Tooze  · 15 Nov 2021  · 561pp  · 138,158 words

LC record available at https://lccn.loc.gov/2021016843 LC ebook record available at https://lccn.loc.gov/2021016844 Cover design: Jason Ramirez Cover image: (coronavirus cell) DigitalVision Vectors / Getty Images Book design and graph illustrations by Daniel Lagin, adapted for ebook by Cora Wigen pid_prh_5.7.1_c0

…

was stressing the weakest parts of our personalities and our most intimate relationships. * * * — There have been far more lethal pandemics. What was dramatically new about coronavirus in 2020 was the scale of the response. And that begs a question. As the Financial Times’s chief economic commentator Martin Wolf put it

…

the very unequal consequences of societal risks, whether those be due to structural change in the global division of labor, environmental damage, or disease.43 Coronavirus glaringly exposed our institutional lack of preparation, what Beck called our “organized irresponsibility.” It revealed the weakness of basic apparatuses of state administration, like up

…

was a long-term world historic shift, to which everyone in the world would eventually have to respond. But Beijing’s success in handling the coronavirus and the assertiveness that unleashed were a red flag to the Trump administration. Furthermore, the superheated atmosphere of the American election generated powerful amplification and

…

vision of American government crafted by successive Democratic administrations starting with Woodrow Wilson and FDR gave American liberals tools with which to respond to the coronavirus challenge. Even the new generation of American radicals led by Alexandria Ocasio-Cortez could find things to like about the New Deal.73 By

…

implications for our history—written from the safety of an Upper West Side apartment could seem remote. The Anthropocene remained an abstract intellectual proposition. The coronavirus crisis has stripped even the most sheltered of us of that illusion. Part I DISEASE X Chapter 1 ORGANIZED IRRESPONSIBILITY Skeptics—and there have been

…

system anywhere in the world that could absorb the caseload of a runaway pandemic. Organized irresponsibility ruled. * * * — As bewildering as its impact was, the 2020 coronavirus crisis was an accident waiting to happen. Not only did our modern way of life supercharge the mutation of potentially dangerous viruses, we carry them

…

-term perspective, and to strengthen and firm up confidence.” The emphasis now was on selectivity and discipline. About half of China’s counties had no coronavirus cases. There, the priority should be “on forestalling imported cases and comprehensively restoring the order of production and life.” For medium-risk regions, the

…

adequacy of public health systems but transatlantic divisions between the United States and Europe, over trade, NATO, and climate policy. Those who were warning about coronavirus, including the WHO boss Tedros Adhanom Ghebreyesus and Kristalina Georgieva of the IMF, struggled to make themselves heard. The main stage was given over to

…

bathrooms, kitchens, or washing facilities—the dilemmas were even more acute. In a labor market hierarchy that, in any case, rewards abstract, disembodied labor, the coronavirus crisis massively compounded existing inequalities. If you had the capacity to extract yourself, you were okay. You could work remotely. You could shop remotely. You

…

of hyperglobalization, fragile and attenuated welfare states, profound social and economic inequality, and the overweening size and influence of private finance. * * * — The fiscal response to coronavirus was a striking expression of combined and uneven development. On the one hand, since virtually every country in the world joined the collective move to

…

Central banks go on a bond-buying spree to support government responses to the pandemic. Data compiled by Bloomberg, https://www.bloomberg.com/graphics/2021-coronavirus-global-debt The central banks didn’t, on the whole, buy the newly issued debt directly. They bought bonds held by banks and investment funds

…

the stock market. It increased financial net worth and boosted demand. The supportive cooperation between central banks and treasuries in the common struggle against the coronavirus was thus, the central bankers adamantly insisted, no more than an incidental side effect of their frantic and clumsy efforts to manage the economy by

…

value; this was priced to panic.”3 How would the emerging markets weather the storm? Would a financial crisis cripple their ability to respond to coronavirus? Would the advanced economies and the international financial institutions, in which the Americans and Europeans have a controlling voice, offer assistance, or would they

…

compound the pressure? The coronavirus crisis was a major test of the economic regime not just of the advanced economies, but of the entire world. * * * — The capital flight of

…

were watching the generous social spending of Bolsonaro’s government with increasing apprehension. How, they asked, would a populist administration respond to another wave of coronavirus?73 More and more investors were willing to buy only short-dated Brazilian debt.74 The new toolkit for managing the risks of financial globalization

…

of the court, but away from it, not putting European solidarity in question, but tending, instead, to reinforce it. * * * — As a near-universal experience, the coronavirus pandemic concentrated minds across the world on a single issue, inducing identification, comparison, and sympathy across borders—Chen’s convergence, linkage, induction, and amplification effects

…

sector unions.30 His hobbyhorse was a liability shield, which would enable an early return to work while protecting employers against lawsuits to do with coronavirus infection. As a license for corporate irresponsibility, this would never pass the Democratic majority in the House.31 President Trump added noise to the

…

vaccine whose efficacy and safety had been legitimately tested and whose production was ramped up to scale were very different things. The drama of the coronavirus vaccine was that for the first time, all three processes—development, testing, ramping up production—were accomplished simultaneously, on a scale intended in due

…

Home,” Responsible Statecraft, June 4, 2020. 76. J. Iadarola, “What if Bernie Has Already Won This Thing?” The Hill, February 23, 2020. S. Hamid, “The Coronavirus Killed the Revolution,” Atlantic, March 25, 2020. 77. G. Ip, “Businesses Fret Over Potential Bernie Sanders Presidency,” Wall Street Journal, March 1, 2020. B. Schwartz

…

”; ecpr.eu/Filestore/PaperProposal/0dac228d-63fb-45c6-8384-21d764abaf6a.pdf. 37. A. Folley, “Texas Lt Gov: ‘Grandparents “Don’t Want the Whole Country Sacrificed” Amid Coronavirus Closures,’ ” The Hill, March 23, 2020. 38. C. Landwehr, “Deciding How to Decide: The Case of Health Care Rationing,” Public Administration 87, no. 3 (

…

Scramble to Avert a Chernobyl Moment,” Washington Post, January 29, 2020. J. Anderlini, “Xi Jinping Faces China’s Chernobyl Moment,” Financial Times, February 10, 2020. “Coronavirus ‘Cover-up’ Is China’s Chernobyl—White House Advisor,” Reuters, May 24, 2020. 5. J. Li, “Chinese People Are Using ‘Chernobyl’ to Channel Their

…

Shutdown Is Believed to Be Without Precedent,” New York Times, January 22, 2020. 16. R. McGregor, “China’s Deep State: The Communist Party and the Coronavirus,” Lowy Institute, July 23, 2020. 17. T. Heberer, “The Chinese ‘Developmental State 3.0’ and the Resilience of Authoritarianism,” Journal of Chinese Governance 1,

…

February 24, 2020. 61. “WHO Director-General Opening Remarks at the Media Briefing on COVID-19,” World Health Organization, February 23, 2020. 62. F. Tang, “Coronavirus: Xi Jinping Rings Alarm on China Economy as Country Shifts Priority to Maintaining Growth,” South China Morning Post, February 24, 2020. 63. R. McMorrow, N

…

M. MacKenzie, “In No Mood for Catching a Falling Knife,” Financial Times, February 25, 2020. 38. R. Wigglesworth, K. Martin, and T. Stubbington, “How the Coronavirus Shattered Market Complacency,” Financial Times, February 28, 2020. 39. MacKenzie, “In No Mood for Catching a Falling Knife.” 40. S. Johnson, “Global Inventories at 7

…

South Korea’s Rapid Response to the COVID-19 Pandemic,” Transportation Research Interdisciplinary Perspectives 5 (2020): 100111. 46. Herszenhorn and Wheaton, “How Europe Failed the Coronavirus Test.” 47. L. Kudlow and K. Evans, CNBC interview transcript, February 25, 2020; www.cnbc.com/2020/02/25/first-on-cnbc-cnbc-transcript-national

…

Trump Visits CDC, Calls Jay Inslee a ‘Snake,’ ” Rev, March 6, 2020. 53. D. Agren, “Mexican Governor Prompts Outrage with Claim Poor Are Immune to Coronavirus,” Guardian, March 26, 2020. 54. “Mexico: Mexicans Need Accurate COVID-19 Information,” Human Rights Watch, March 26, 2020. 55. F. Ng’wanakilala, “Tanzanian President

…

M. Fletcher, “Britain and Covid-19: A Chronicle of Incompetence,” New Statesman, July 1, 2020. 58. J. Horowitz, “The Lost Days That Made Bergamo a Coronavirus Tragedy,” New York Times, November 29, 2020. CHAPTER 4. MARCH: GLOBAL LOCKDOWN 1. P. Smith, “An Overview and Market Size of Tradable Commodities,” The Tradable

…

, “China Laps U.S. in Latin America with Covid-19 Diplomacy,” Bloomberg, June 24, 2020. 52. L. Paraguassu and J. McGeever, “Brazil Government Ad Rejects Coronavirus Lockdown, Saying #BrazilCannotStop,” Reuters, March 27, 2020. 53. “Federal Judge Bans Bolsonaro’s ‘Brazil Cannot Stop’ Campaign,” teleSUR, March 28, 2020. 54. D. Agren, “

…

56. Morning Conference with A. M. López Obrador, “Versión estenográfica de la conferencia de prensa matutina,” March 11, 2020. 57. T. Phillips, “Mexican President Ignores Coronavirus Restrictions to Greet El Chapo’s Mother,” Guardian, March 30, 2020. 58. R. Costa and P. Rucker, “Inside Trump’s Risky Push to Reopen the

…

A. Olson and C. Bussewitz, “Child Care Crisis Pushes US Mothers Out of the Labor Force,” AP News, September 4, 2020. 35. M. Paxton, “The Coronavirus Threat to Wildlife Tourism and Conservation,” United Nations Development Programme, April 21, 2020. “Global Wildlife Tourism Generates Five Times More Revenue Than Illegal Wildlife Trade

…

Conservation.” 38. J. K. Elliot, “Thailand’s ‘Monkey City’ Overrun by Gangs of Hungry, Horny Macaques,” Global News, June 24, 2020. 39. D. Jones, “The Coronavirus Pandemic Has Halted Tourism, and Animals Are Benefiting from It,” Washington Post, April 3, 2020. 40. M. Toyana, “Jobs Gone, Investments Wasted: Africa’s Deserted

…

Stracqualursi and A. Kurtz, “Trump Administration Asking States to Delay Release of Unemployment Numbers,” CNN, March 20, 2020. 61. G. Iacurci, “Job Losses Remain ‘Enormous’: Coronavirus Unemployment Claims Are Worst in History,” CNBC, July 9, 2020. 62. “2020: Charts from a Year Like No Other,” Financial Times, December 29, 2020. 63

…

M. Ashworth, “Germany’s ‘Black Zero’ Rule May Be Gone Forever,” Bloomberg, February 26, 2020. 14. M. Nienaber, “German Parliament Suspends Debt Brake to Fight Coronavirus Outbreak,” Reuters, March 25, 2020. 15. G. Chazan, “Scholz Insists Record German Borrowing Manageable,” Financial Times, June 17, 2020. “Germany Opens the Money Tap,” Economist

…

—China’s Recovery and International Response,” ODI Economic Pulse series, November 2020. 19. J. Sipalan, “Malaysia Announces $58-Billion Stimulus Package to Cushion Impact of Coronavirus,” Reuters, March 27, 2020. 20. J. Follain, “Italian Leader Takes to Basement to Plot How to Fight Virus,” Bloomberg, March 9, 2020. 21. J.

…

of Retail Investors Are Trading with Leverage,” Yahoo!, September 9, 2020. CHAPTER 8. THE TOOLKIT 1. J. Wheatley and A. Schipani, “Bolsonaro, Brazil and the Coronavirus Crisis in Emerging Markets,” Financial Times, April 19, 2020. “COVID-19 and Global Capital Flows,” Organisation for Economic Co-operation and Development, July 3, 2020

…

. 2. http://www.worldgovernmentbonds.com/cds-historical-data/brazil/5-years/. 3. Wheatley and Schipani, “Bolsonaro, Brazil and the Coronavirus Crisis in Emerging Markets.” 4. “Global Financial Stability Report,” International Monetary Fund, October 2019. 5. D. Gabor, “The Wall Street Consensus,” SocArXiv, July 2,

…

,” Financial Times, April 17, 2020. 51. G. Long, “Ecuador Takes Far-Reaching Measures to Save Economy,” Financial Times, May 20, 2020. 52. M. Stott, “Coronavirus Set to Push 29m Latin Americans into Poverty,” Financial Times, April 27, 2020. 53. “Peru Is Heading Towards a Dangerous New Populism,” Economist, July 25

…

, June 17, 2020. 64. “Brazil Faces Hard Spending Choices in 2021,” Economist, December 16, 2020. 65. M. Viotti Beck and A. Rosati, “Brazil’s Coronavirus Splurge Is Sparking a Rebellion in Markets,” Bloomberg, October 27, 2020. 66. B. Harris, “Brazil’s Economy Rebounds in Third Quarter,” Financial Times, December 3

…

been twitter.com/70sBachchan. 54. A. Thompson, “A Running List of Record-Breaking Natural Disasters in 2020,” Scientific American, December 22, 2020. 55. T. Fuller, “Coronavirus Limits California’s Efforts to Fight Fires with Prison Labor,” New York Times, August 22, 2020. 56. J. Poushter and C. Huang, “Despite Pandemic, Many

…

D. Diamond, “The Crash Landing of ‘Operation Warp Speed,’ ” Politico, January 17, 2021. 29. LaFraniere et al., “Politics, Science and the Remarkable Race for a Coronavirus Vaccine.” 30. B. Pancevski, “Germany Boosts Investment in Covid-19 Vaccine Research,” Wall Street Journal, September 15, 2020. 31. “Germany: Investment Plan for Europe—EIB

…

for COVID-19 Vaccine Development and Manufacturing,” European Investment Bank, June 11, 2020. 32. LaFraniere et al., “Politics, Science and the Remarkable Race for a Coronavirus Vaccine.” 33. L. Facher, “Amid Broad Mistrust of FDA and Trump Administration, Drug Companies Seek to Reassure Public About Covid-19 Vaccine Safety,” Stat, September

…

and M. DeBonis, “How Moonshine, Multi-Hour Zooms and a Deadly Pandemic Pushed Congress to Approve New Stimulus,” Washington Post, December 22, 2020. C. Hulse, “Coronavirus Stimulus Bolsters Biden, Shows Potential Path for Agenda,” New York Times, December 21, 2020. 7. www.youtube.com/watch?v=qOOPzkHF6yc. N. Rummell, “Intercession of

…

), 129 Moody’s rating agency, 166, 257–58, 270 Moore, Stephen, 76 Morawiecki, Mateusz, 280 Moreno, Lenín, 8, 168 Morin, Edgar, 6 mortality rates of coronavirus pandemic, 28, 36–37, 37–41, 169, 171 mortgage-backed securities, 14, 113–15, 117, 122, 129, 144 mRNA technology, 244, 246, 289 Müller,

Rigged: How the Media, Big Tech, and the Democrats Seized Our Elections

by Mollie Hemingway  · 11 Oct 2021  · 595pp  · 143,394 words

more valid in 2020, an election year unlike any other in American history. In the lead-up to the election, thanks in part to the coronavirus pandemic that gripped the world, wide-ranging electoral reforms were implemented. Across the country at the state, local, and federal levels, political actors rammed

…

and the building of walls.”114 STAT, a health and medicine news site, ran a piece headlined, “Health Experts Warn China Travel Ban Will Hinder Coronavirus Response,” and said the ban was desired by “conservative lawmakers and far-right supporters of the president,” even as “public health experts… warn that the

…

doing too little, members of the media tried to rewrite recent history. Politico’s Dan Diamond retroactively claimed, “[I]n late January, Trump’s initial coronavirus moves were widely hailed as [a] strong and appropriate response.”117 Early on, though, the conventional wisdom was that there was no need to panic

…

Moody’s Analytics model that showed him a strong favorite to win.124 By March, the realization among Democrats and their media allies that the coronavirus outbreak was much more serious than they had previously thought coincided with the realization that they could benefit politically from a pandemic. Once Trump opponents

…

News added, “Frequent hand-washing, not wearing a face mask, is the most important step the public can take to prevent the spread of the coronavirus, the World Health Organization said.”134 Naturally, the bureaucrats’ anti-mask message was contrasted with Trump’s willingness to cast about for a wide variety

…

spreading false hope for a virus cure—and that’s not the only damage,” the Washington Post opined.143 “Trump is spreading misinformation about the coronavirus—time to take away his microphone. Cable news networks should stop airing the president’s COVID-19 press conferences live,” argued the Boston Globe.144

…

contribution had gone to a “pro-science super PAC.”148 Finally, the politicized reaction started to impact the medical community’s ability to objectively assess coronavirus treatments. A study that had concluded hydroxychloroquine was dangerous to patients received much media coverage. Then the journal The Lancet pulled it because the authors

…

media favorite list. In particular, the media were obsessed with the daily press conferences held by Cuomo, leader of the state hit hardest by the coronavirus. Anyone paying attention would have noticed that Cuomo frequently agreed with the president. After harshly criticizing Trump for saying hydroxychloroquine had promise, the media didn

…

pandemic crisis.” Politico barely stopped itself from putting actual profanity in a headline: “ ‘Dumbest S—’: DeSantis Takes Heat as He Goes His Own Way on Coronavirus.” Unlike Cuomo, DeSantis not only made the correct call not to return COVID-19 patients to nursing homes, but Florida significantly outperformed New York in

…

both per capita coronavirus cases and deaths in the state. * * * Even though the evidence showed China’s communist government, aided by an incompetent and credulous World Health Organization,

…

a “China virus” or “Wuhan virus” was xenophobic, it represented yet another shameless about-face. Media outlets had already spent months referring to the “Wuhan coronavirus” and various other names that clearly reflected the virus’s foreign origin. On March 12, the conservative Media Research Center put together a video showing

…

“we’re starting to see a message shift here because you’re starting to hear the Republicans, especially Trump, call it the ‘Wuhan’ or ‘Chinese coronavirus.’ They’re looking for someone to blame.” Cuomo’s insipid observation was then followed by nearly two minutes of clips from media figures, including several

…

CNN journalists, referring over the previous two months to the “Wuhan” or “Chinese coronavirus.”160 But the media’s shamelessness persisted. Instead of focusing on public health questions during daily White House press briefings, the press feigned outrage over

…

to the public, as had been long suspected. One email showed Peter Daszak, president of EcoHealth Alliance, thanking Fauci for publicly dismissing concerns that the coronavirus was created in a lab. EcoHealth Alliance has worked with the Wuhan Institute of Virology. In an email, Fauci also dismissed the idea that the

…

helped support that message. Whether it was the cause or effect of the messaging focus, polls showed that Democrats were much more terrified of the coronavirus than Republicans were.8 As important as a virtual convention was to Democratic messaging, an in-person convention was for Republicans. Trump repeatedly emphasized that

…

Hicks, who had traveled with the president at least three times in the previous week and participated in debate prep, had tested positive for the coronavirus.40 After midnight, Trump tweeted that he and Melania had tested positive and would begin their quarantine and recovery process immediately.41 It was a

…

very strong start to the vice-presidential debate, with a rehearsed but very effective answer criticizing the Trump administration for its failure to bring the coronavirus epidemic to heel. But when pressed for details on what she’d do differently, she struggled and never quite regained a strong footing. She

…

pay for the parts of Democrats’ mail-in ballot strategy that state and local governments themselves could do, claiming it was necessary because of the coronavirus. Congress allocated hundreds of millions of dollars, but the progressive activists needed much more to accomplish their vision. That’s when “[p]rivate philanthropy

…

Bay, Madison, Milwaukee, and Kenosha to ensure voting could be “done in accordance with prevailing public health requirements” to “reduce the risk of exposure to coronavirus.”119 Wisconsin law says voting is a right, but that voting absentee is a privilege. “[V]oting by absentee ballot must be carefully regulated to

…

was downplayed in favor of liberals’ alleging Trump was racist.49 Just as the 2020 general election campaign got going, media-induced hysteria over the coronavirus sent not just the country but the world into a tailspin. Any attempt to hold the communist government of China accountable for unleashing the virus

…

any election loss, but what Democrats did to the manner in which people vote was further destabilizing to the country. Democrats took advantage of the coronavirus global pandemic to foist upon the country election rules explicitly designed to favor their party. Since before the country was founded, Americans have been fighting

…

as Emergency Fed Action Fails to Mollify Investors,” Washington Post, March 16, 2020, https://www.washingtonpost.com/business/2020/03/16/stocks-markets-live-updates-coronavirus/. 14. “A Timeline of COVID-19 Developments in 2020,” American Journal of Managed Care, updated January 1, 2021, https://www.ajmc.com/view/a-

…

Election Puts Poll Workers at Risk of Virus,” New York Times, April 2, 2020, https://www.nytimes.com/2020/04/02/us/politics/wisconsin-election-coronavirus.html. 24. Alex Seitz-Wald and Shaquille Brewster, “GOP Lawmakers Reject Wisconsin Governor’s Call for Delay in Election Results,” NBC News, April 3,

…

State’s Latest Whipsaw,” Washington Post, April 7, 2020, https://www.washingtonpost.com/politics/wisconsin-governor-suspends-in-person-voting-in-tuesdays-elections-amid-escalating-coronavirus-fears/2020/04/06/9d658e2a-781c-11ea-b6ff-597f170df8f8_story.html. 26. Laurel White, “Postmark Irregularities Could Disqualify Ballots Sent on or before Election Day

…

Lisa Lerer, “Wisconsin Votes Tomorrow. In Person,” New York Times, April 6, 2020, https://www.nytimes.com/2020/04/06/us/politics/on-politics-wisconsin-coronavirus.html. 28. John McCormack, “CDC Study Shows No COVID-19 Spike from Wisconsin’s April Election,” National Review, July 31, 2020, https://www.nationalreview.com

…

/2020/07/cdc-study-wisconsin-elections-caused-no-coronavirus-spike/. 29. David Wahlberg, “No COVID-19 Surge in Milwaukee from Wisconsin’s April 7 Election, CDC Says,” Wisconsin State Journal, August 3, 2020,

…

, 2016,” Ballotpedia, n.d., https://ballotpedia.org/Wisconsin%27s_7th_Congressional_District_election. 43. Donald Judd, “Donald Trump Holds ‘Tele-Rally’ in Campaign First amid Coronavirus Pandemic,” CNN, July 18, 2020, https://www.cnn.com/2020/07/18/politics/donald-trump-telerally-campaign-event/index.html. 44. Bauer, “Trump-Backed Tom

…

, https://www.cbsnews.com/news/georgia-postpones-presidential-primary-scheduled-for-march-24-2020-03-14/. 66. Ben Nadler, “Georgia Postpones Primaries Again because of Coronavirus,” Associated Press, April 9, 2020, https://apnews.com/article/public-health-primary-elections-us-news-ap-top-news-elections-d0a07a2989f7399c6b14e2276b482526. 67. Richard Fausset and Reid

…

strong and appropriate response…,” Twitter, March 8, 2020, 9:22 a.m., https://twitter.com/ddiamond/status/1236643371734765568. 118. Gerry Shih et al., “As Deadly Coronavirus Spreads, U.S. to Expand Screening of Passengers from China at 20 Airports,” Washington Post, January 27, 2020, https://www.washingtonpost.com/health/as-deadly

…

9:31 p.m., https://twitter.com/RepGosar/status/1242625203844325376. 120. Lenny Bernstein, “Get a Grippe, America. The Flu Is a Much Bigger Threat Than Coronavirus, for Now,” Washington Post, February 1, 2020, https://www.washingtonpost.com/health/time-for-a-reality-check-america-the-flu-is-a-much-bigger-threat

…

-government-health-agency-official-corona-virus-isnt-something-the. 122. KPIX CBS SF Bay Area, “Speaker Pelosi Visits SF’s Chinatown to Show Support amid Coronavirus Fears,” YouTube, February 24, 2020, https://www.youtube.com/watch?time_continue=134&v=eFCzoXhNM6c&feature=emb_title. 123. David Siders, “Dems Sweat Trump’

…

concerned/. 141. Stephen Collinson, “Trump Peddles Unsubstantiated Hope in Dark Times,” CNN, March 20, 2020, https://www.cnn.com/2020/03/20/politics/donald-trump-coronavirus-false-hope/index.html. 142. Elizabeth Cohen et al., “Trump Says This Drug Has ‘Tremendous Promise,’ but Fauci’s Not Spending Money on It,” CNN

…

thats-not-the-only-damage/2020/03/25/587b26d8-6ec3-11ea-b148-e4ce3fbd85b5_story.html. 144. Michael A. Cohen, “Trump Is Spreading Misinformation about the Coronavirus—Time to Take Away His Microphone,” Boston Globe, March 20, 2020, https://www.bostonglobe.com/2020/03/20/opinion/take-away-trumps-microphone/. 145. Sonam

…

Stress This Enough, This Will Kill You’: Fox News Host Neil Cavuto Was Shocked by Trump’s Announcement That He’s Taking Hydroxychloroquine to Prevent Coronavirus,” Business Insider, May 18, 2020, https://www.businessinsider.com/fox-news-neil-cavuto-shocked-trump-hyroxychloroquine-announcement-video-2020-5. 146. Erika Edwards and Vaughn

…

thedailybeast.com/trump-addresses-kung-flu-remark-says-asian-americans-agree-100-with-him-using-chinese-virus. 163. Kamala Harris (@VP), “Calling it the ‘Chinese coronavirus’ isn’t just racist, it’s dangerous and incites discrimination against Asian Americans and Asian immigrants…,” Twitter, March 10, 2020, 12:52 p.m., https

…

Masks. China Makes Them, but Has Been Hoarding Them,” New York Times, April 2, 2020, https://www.nytimes.com/2020/03/13/business/masks-china-coronavirus.html. 170. Helen Davidson, “First COVID-19 Case Happened in November, China Government Records Show—Report,” The Guardian, March 13, 2020, https://www.theguardian.

…

/1261338735355899906?lang=en. 185. “The Upside of Crisis,” Kite and Key Media, March 2021, https://www.kiteandkeymedia.com/videos/covid-19-crisis-management-federal-government-coronavirus-pandemic-emergency-vaccine/?utm_source=social&utm_medium=twitter. 186. NPR (@NPR), “Fact Check: President Trump said of a vaccine: ‘It’s ready. It’s

…

Owermohle, “Pfizer Trying to Defuse Critics amid Push for Vaccine before Election Day,” Politico, October 9, 2020, https://www.politico.com/news/2020/10/09/coronavirus-vaccine-pfizer-election-day-428371. 189. Matthew Herper, “COVID-19 Vaccine from Pfizer and BioNTech Is Strongly Effective, Early Data from Large Trial Indicate,” STAT

…

trump-calls-george-floyds-death-a-terrible-thing-2020-05-29/. 15. Scott Neuman, “Medical Examiner’s Autopsy Reveals George Floyd Had Positive Test for Coronavirus,” NPR, June 4, 2020, https://www.npr.org/sections/live-updates-protests-for-racial-justice/2020/06/04/869278494/medical-examiners-autopsy-reveals-george-floyd

…

-had-positive-test-for-coronavirus. 16. Akshita Jain, “George Floyd’s Killing Not a Hate Crime because It Was Systemic Not ‘Explicit’ Racism, Says Official,” The Independent, April 26,

…

-convention. 10. Dan Merica, Ryan Nobles, and Jeremy Diamond, “Trump Says GOP Forced to Find New State to Host Convention as North Carolina Stands by Coronavirus Measures,” CNN, June 3, 2020, https://www.cnn.com/2020/06/02/politics/republican-national-convention-location/index.html. 11. Jim Morrill, “The RNC

…

-superspreader-event-n1242781. 13. Elle Thomas, “Sen. Mike Lee Tests Positive for COVID-19,” FOX 13, October 2, 2020, https://www.fox13now.com/news/coronavirus/local-coronavirus-news/sen-mike-lee-tests-positive-for-covid-19. 14. Jonah Goldberg, “Ruth Bader Ginsburg and a Question of Eugenics,” Chicago Tribune, July 16, 2009

…

ct-xpm-2009-07-16-0907150564-story.html. 15. Tom Hamburger, “Two Students and a Teacher at School Attended by Barrett Children Test Positive for Coronavirus,” Washington Post, October 9, 2020, https://www.washingtonpost.com/politics/barrett-children-school-covid/2020/10/09/ac130298-0a40-11eb-9be6-cf25fb429f1a_story.html. 16

…

Will Be Hospitalized ‘for the Next Few Days,’ ” CNN, October 3, 2020, https://www.cnn.com/2020/10/02/politics/president-donald-trump-walter-reed-coronavirus/index.html. 47. Jennifer Rubin (@JRubinBlogger), “Totally unacceptable we have not heard from a doctor. Has the 25th amendment been invoked???,” Twitter, October 2,

…

of ‘Inflicting’ Failures on Americans,” Daily Caller, October 4, 2020, https://dailycaller.com/2020/10/04/get-well-get-it-together-jake-tapper-trump-failures-coronavirus/. 54. Barbara Sprunt, “Despite Risks to Others, Trump Leaves Hospital Suite to Greet Supporters,” NPR, October 4, 2020, https://www.npr.org/sections/latest-

…

. 173. Christina A. Cassidy, “Voter Outreach Led to Big Drop in Rejected Mail Ballots,” Associated Press, March 16, 2021, https://apnews.com/article/politics-wisconsin-coronavirus-pandemic-elections-atlanta-25b5218ee92dadf78be274211bef6c6b. 174. Litke, “Fact Check: Wisconsin’s November Absentee Rejection Rate Was in Line.” 175. Nathaniel Rakich, “Why So Few Absentee Ballots

How to Survive a Pandemic

by Michael Greger, M.D., FACLM  · 1,072pp  · 237,186 words

? Where do new infectious diseases come from? All human viral infections are believed to originate in animals.9 The Emergence of MERS Most human coronaviruses appear to have arisen originally in bats,10 which make good viral hosts. Up to two hundred thousand can crowd together in dense roosting colonies

…

they were confined indoors. The high-intensity contact between camels alongside their workers is thought to be what helped drive the spillover of the MERS coronavirus from camels to humans. By 2011, open grazing was completely banned in Qatar, the Middle Eastern country with the highest camel density. The next

…

the genetic sequences of the viruses obtained from some of the early human victims were 99.98 percent identical despite the rapid mutation rate of coronaviruses suggests the current pandemic originated within a very short period from a single source.67 Although there have been documented reports of SARS-CoV escaping

…

mammal in the world.77 Although other potential intermediate hosts were investigated, including snakes78 and turtles,79 most attention has turned to pangolins, after a coronavirus found in diseased pangolins being smuggled from Malaysia into China was found to be about 90 percent identical with the COVID-19 virus.80 Samples

…

anyone can go online and buy Chinese bat feces (Yè ming shǎ) to “treat … eye disorders.”100 While the drying of excrement would presumably inactivate coronavirus, the handling and trade of live and recently killed bats for use in traditional remedies could infect people directly or introduce opportunities for cross infection

…

last decade,110 rapidly spreading coast to coast once it reached U.S. shores in 2014.111 This pattern of emergence and outbreaks of new coronaviruses appears to be accelerating, in part because “intensive farm-management practices result in thousands of animals being housed together in a closed environment.”112 Although

…

can do about it. And just as eliminating the exotic animal trade and live animal markets may go a long way toward preventing the next coronavirus pandemic, reforming the way we raise domesticated animals for food may help forestall the next killer flu. I STORM GATHERING 1918 “Humanity has but

…

through the mucus layer to attack the respiratory cells underneath,316 before moving aside as the hemagglutinin spikes take over. Like the spike proteins coating coronaviruses, hemagglutinin is the key the flu virus uses to get inside our cells. The cells of our body are sugar-coated. The external membrane

…

over one another, spewing potential pathogens throughout the market wet with blood and urine.1004 These viral swap meets are blamed for the transformation of coronaviruses, previously known for causing the common cold, into a killer.1005 If hindsight were twenty-twenty and the wet markets had been closed permanently,

…

performed at the Nebraska Biocontainment Unit and the National Quarantine Unit found the majority of air samples tested positive for traces of the COVID-19 coronavirus—even in the hallways outside of patients’ rooms. However, the researchers were unable to verify if the airborne virus was infectious, given the extremely

…

misted into the air,2815 special care should certainly be taken during aerosol-generating medical procedures. How long does the virus last on contaminated surfaces? Coronaviruses are “enveloped” viruses, wrapped in a stolen swath of our own cell membranes. As they bud out of infected cells, they cloak themselves in

…

However, the CDC has since published evidence by a respected team of researchers funded by the European Commission and German government that the COVID-19 coronavirus could be inactivated within thirty seconds by just 30 percent alcohol (either ethyl or isopropyl).2854 In that case, a variety of hard liquors

…

at the National Academy of Sciences told the White House that “[c]urrently available research supports the possibility that SARS-CoV-2 [the COVID-19 coronavirus] could be spread via bioaerosols generated directly by patients’ exhalation.”2892 This shouldn’t be surprising. After all, respiratory droplets are not just sneezed

…

peaking every winter,2930 there are other respiratory virus infections that peak in the spring or summer.2931 In fact, MERS-CoV, the last deadly coronavirus to cause an epidemic, peaked in August in the sweltering heat and blistering sun of the Arabian Peninsula.2932 The mechanisms underlying the seasonality of

…

80 percent alcohol were found more effective than soap in every scientific study available for review, and, as I’ve discussed, enveloped viruses such as coronaviruses and influenza are especially susceptible to topical alcohol sanitizers. Alcohol solutions not only were found to be more effective at eliminating germs, but require less

…

most highly valued barter items in crisis situations.3047 As I mentioned before, a group of respected researchers posted preliminary evidence that the COVID-19 coronavirus could be inactivated by half that alcohol concentration, but for an all-purpose pandemic sanitizer—one rub to rule them all—I would recommend sticking

…

Francisco mayor threatened to arrest anyone unmasked.3054 Within thirty-six hours, the SFPD had hauled in 175 “mask-slackers.”3055 The main mode of coronavirus and influenza virus transmission may be coughed and exhaled respiratory droplets of virus-laden mucus and saliva. Conversational speech alone can produce thousands of these

…

plans.3081 Currently, the WHO recommends masks only for asymptomatic individuals if they are taking care of someone suspected of infection with the COVID-19 coronavirus.3082 In terms of individual strategies, the best recommendation may be what finally shook out of the SARS crisis:3083 in public, surgical masks

…

tonight.”3226 Just as past experience with SARS may have helped countries like Singapore and Taiwan better deal with COVID-19, hard lessons from the coronavirus pandemic will hopefully translate into global readiness for the next one. Pandemic planning needs to be on the agenda of every institution, including every school

…

: WHO; [accessed 2020 Mar 23]. https://www.who.int/csr/sars/country/table2004_04_21/en/. 8. World Health Organization. 2019. Middle East respiratory syndrome coronavirus (MERS-CoV). Geneva: WHO; [updated 2019 Nov; accessed 2020 Mar 23]. http://origin.who.int/emergencies/mers-cov/en. 9. Weber J, Alcorn K.

…

2020 Jan 25. Live animal markets worldwide can spawn diseases, experts say. Voice of America. [accessed 2020 Apr 11]; https://www.voanews.com/science-health/coronavirus-outbreak/live-animal-markets-worldwide-can-spawn-diseases-experts-say. 49. Zhong NS, Zeng GQ. 2008. Pandemic planning in China: applying lessons from severe acute

…

Wassenaar TM, Zou Y. 2020. 2019_nCoV/SARS-CoV-2: rapid classification of betacoronaviruses and identification of Traditional Chinese Medicine as potential origin of zoonotic coronaviruses. Lett Appl Microbiol. 70(5):342–348. https://doi.org/10.1111/lam.13285. 102. National Administration of Traditional Chinese Medicine. 2020 Feb 4.

…

Notice on the issuance of a new coronavirus infection pneumonia diagnosis and treatment plan. Beijing: National Health Commission. Report No.: 103. http://www.gov.cn/zhengce/zhengceku/2020-02/05/5474791/files/de44557832ad4be1929091dcbcfca891

…

Peng L, Zhou J, Zhu SJ, Huang Y-W. 2019. Broad cross-species infection of cultured cells by bat HKU2-related swine acute diarrhea syndrome coronavirus and identification of its replication in murine dendritic cells in vivo highlight its potential for diverse interspecies transmission. J Virol. 93(24):e01448-19. https

…

Cook RA. 2005. The human-animal link. Foreign Affairs 84(4):38–50. 984. Bell D, Roberton S, Hunter PR. 2004. Animal origins of SARS coronavirus: Possible links with the international trade in small carnivores. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1447):1107–14

…

20. www.usatoday.com/news/offbeat/2004-01-20-civet-coffee_x.htm. 991. Bell D, Roberton S, Hunter PR. 2004. Animal origins of SARS coronavirus: possible links with the international trade in small carnivores. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1447):1107–14

…

China Daily, October 14. english.people.com.cn/200410/12/eng20041012_159879.html. 999. Bell D, Roberton S, Hunter PR. 2004. Animal origins of SARS coronavirus: possible links with the international trade in small carnivores. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1447):1107–14

…

and Prevention, Emerging Infectious Diseases 11(10). www.cdc.gov/ncidod/EID/vol11no10/05-0513.htm. 1066. Afelt A, Frutos R, Devaux C. 2018. Bats, coronaviruses, and deforestation: toward the emergence of novel infectious diseases? Front Microbiol. 9:702. https://doi.org/10.3389/fmicb.2018.00702. 1067. Fritsch P. 2003

…

6. 1959. Shortridge KF. 1992. Pandemic influenza: a zoonosis? Seminars in Respiratory Infections 7:11–25. 1960. Afelt A, Frutos R, Devaux C. 2018. Bats, coronaviruses, and deforestation: toward the emergence of novel infectious diseases? Front Microbiol. 9:702. https://dx.doi.org/10.3389/fmicb.2018.00702. 1961. Webster RG

…

/channel/health/mg18825215.900.html. 2584. Bush RM. 2004. Influenza as a model system for studying the cross-species transfer and evolution of the SARS coronavirus. Philosophical Transactions of the Royal Society of London B 359:1067–73. 2585. Goodman J. 2005. Meeting the challenge of pandemic vaccine preparedness: an

…

who-audio-script-ncov-rresser-unog-29jan2020.pdf. 2669. Tedros AG. 2020 Jan 30. WHO Director-General’s statement on IHR Emergency Committee on Novel Coronavirus (2019-nCoV). World Health Organization. [accessed 2020 Mar 31]. https://www.who.int/dg/speeches/detail/who-director-general-s-statement-on-ihr-emergency-committee

…

31]. https://doi.org/10.1101/2020.03.15.20035360. 2712. Zhang Y. 2020 Feb 17. The epidemiological characteristics of an outbreak of 2019 novel coronavirus diseases (COVID-19)—China, 2020. Chinese Center for Disease Control and Prevention. CCDC Weekly. [accessed 2020 Mar 31]. http://weekly.chinacdc.cn/en/article/

…

V, Noulette J, Duhamel A, Labreuche J, Mathieu D, Pattou F, Jourdain M, et al. 2020. High prevalence of obesity in severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) requiring invasive mechanical ventilation. Obesity. Accepted articles. [accessed 2020 Apr 11]. https://doi.org/10.1002/oby.22831. 2725. Huang R

…

active during self-quarantine. Copenhagen: WHO Regional Office for Europe; [accessed 2020 Mar 31]. http://www.euro.who.int/en/health-topics/health-emergencies/coronavirus-covid-19/novel-coronavirus-2019-ncov-technical-guidance/stay-physically-active-during-self-quarantine. 2768. World Health Organization. 2018 Oct 23. Healthy diet. Geneva: WHO; [accessed 2020

…

infection, innate immunity, and childhood. JAMA Pediatr. 169(10):956–963. https://doi.org/10.1001/jamapediatrics.2015.1387. 2770. Zimmermann P, Curtis N. 2020. Coronavirus infections in children including COVID-19: an overview of the epidemiology, clinical features, diagnosis, treatment and prevention options in children. Pediatr Infect Dis J. [Epub

…

on inanimate surfaces. Microbes Environ. 30(2):140–144. https://doi.org/10.1264/jsme2.ME14145. 2817. Geller C, Varbanov M, Duval RE. 2012. Human coronaviruses: insights into environmental resistance and its influence on the development of new antiseptic strategies. Viruses. 4(11):3044–3068. https://doi.org/10.3390/v4113044

…

J, Engelmann M, Todt D, Windisch MP, et al. Virucidal activity of World Health Organization-recommended formulations against enveloped viruses, including Zika, Ebola, and emerging coronaviruses. J Infect Dis. 215(6):902–906. https://doi.org/10.1093/infdis/jix046. 2851. Boyce JM, Pittet D. 2002. Guideline for hand hygiene in

…

our-services/public-cleanliness/environmental-cleaning-guidelines/guidelines-for-environmental-cleaning-and-disinfection. 2859. Kampf G, Todt D, Pfaender S, Steinmann E. 2020. Persistence of coronaviruses on inanimate surfaces and their inactivation with biocidal agents. J Hosp Infect. 104(3):246–251. https://doi.org/10.1016/j.jhin.2020.01

…

1, 2020). Washington(DC): National Academies Press. https://doi.org/10.17226/25769. 2893. Cohen J. 2020 Mar 27. Not wearing masks to protect against coronavirus is a ‘big mistake,’ top Chinese scientist says. Science. [accessed 2020 Apr 6]. https://doi.org/10.1126/science.abb9368. 2894. Centers for Disease Control

…

and Prevention. 2020. Coronavirus disease 2019 (COVID-19): recommendations for cloth face covers. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 3; accessed 2020 Apr

…

people—STOP BUYING MASKS! Twitter.com; [accessed 2020 Apr 6]. https://twitter.com/surgeon_general/status/1233725785283932160. 2896. Centers for Disease Control and Prevention. 2020. Coronavirus disease 2019 (COVID-19): recommendations for cloth face covers. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 3; accessed 2020 Apr

…

6]. https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/cloth-face-cover.html. 2897. Centers for Disease Control and Prevention. 2009 Sep 24. Interim recommendations for facemask and respirator

…

cloth face covers FAQs. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 4; accessed 2020 Apr 6]. https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/cloth-face-cover-faq.html. 2905. Livingston E, Desai A, Berkwits M. 2020. Sourcing personal protective equipment during the COVID

…

ultrafine particles. medRxiv.org. [accessed 2020 Apr 19]. https://doi.org/10.1101/2020.04.14.20065375. 2910. Centers for Disease Control and Prevention. 2020. Coronavirus disease 2019 (COVID-19): cloth face covers. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 4; accessed 2020 Apr 6]. https

…

://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/diy-cloth-face-coverings.html. 2911. National Environmental Agency. 2020 Jan 28. Interim guidelines for environmental cleaning and disinfection in

…

and recommendations for national measures before and during pandemics. www.who.int/csr/resources/publications/influenza/GIP_2005_5Eweb.pdf. 3082. World Health Organization. 2020. Coronavirus disease (COVID-19) advice for the public: when and how to use masks. Geneva: WHO; [accessed 2020 Apr 7]. https://www.who.int/emergencies/

Covid-19: The Pandemic That Never Should Have Happened and How to Stop the Next One

by Debora MacKenzie  · 13 Jul 2020  · 266pp  · 80,273 words

case turned up in Thailand. “Sticking my neck out to the chopping block, I suspect there may already be significant ongoing transmission of this novel coronavirus,” Pollack wrote on ProMED. However, most cases were not being reported, because they were mild and unrecognized. About that, she wrote, “I obviously hope

…

was nothing like SARS. “Clinical presentations greatly resemble SARS-CoV. The number of deaths is rising quickly,” they wrote. “We are concerned that the novel coronavirus could have acquired the ability for efficient human transmission”—in other words, better than the clumsy SARS virus. Scientists are good at understatement, but that

…

tracing, to break all the chains of transmission before there were many cases. In fact, those were tools China already had. In 2003, the SARS coronavirus initially spread out of control in China, and eventually in countries around the world, because doctors’ initial warnings about the outbreak were stifled, at first

…

privacy experts have valid concerns about the expanded electronic surveillance involved. But the virus was contained. You didn’t need a history of tangling with coronaviruses to do the right thing, though. The small Italian town of Vò in Lombardy kept the virus under control by testing everyone and then imposing

…

panel of scientists made the original selection. To be fair, though, they didn’t completely fail to predict this pandemic: the first list did include “coronaviruses.” We knew the risk. Most of the priority pathogens, however, are not previously unknown viruses lurking in wildlife in a hotspot. All but one were

…

Chinese scientists were already warning that the virus could well lurk in other species. Also that year, virologists at the Wuhan Institute of Virology reported coronaviruses that were very similar to SARS in bats, which were also sold at markets. “If no action is taken to control wildlife markets,” Zhong Nanshan

…

a conservation as well as disease-hunting organization, says Olival, “we don’t want to harm the bats.” The samples from Yunnan are analyzed for coronaviruses, but PREDICT has operations like this looking at different kinds of high-risk wildlife, and different pathogens, in Bangladesh, Brazil, Colombia, Indonesia, Malaysia, and

…

and human cells. It was also instantly recognized by antibodies, immune proteins that are highly specific for particular pathogens, from SARS patients in 2003. “Bat coronaviruses remain a substantial global threat to public health,” Shi’s team concluded. In 2017, the team reported more SARS-like viruses from the bats and

…

an increased probability that this will occur in China,” Shi wrote in a review of the research just last year. “Therefore, the investigation of bat coronaviruses becomes an urgent issue for the detection of early warning signs.” Every disaster movie starts with someone ignoring a scientist. It is now too late

…

Chinese scientists, most in Wuhan, and the new disease was raging in their town. They recapped the work to date: they had discovered SARS-like coronaviruses in their natural reservoir, bats. “Previous studies have indicated that some of those bat SARS-CoVs have the potential to infect humans,” they recalled. The

…

good “for vision, especially at night.” (In fact, bats have excellent vision for the same reason birds do: they fly.) Sampling in Yunnan found bat coronaviruses in fresh horseshoe bat feces. Drying fresh bat droppings collected in the wild might kill viruses in it, but possibly not always completely, especially if

…

though? The aim of the WHO’s R&D roadmap is to develop vaccines, treatments, and diagnostics for its list of priority pathogens, which includes coronaviruses in general. In theory, we could have done that. In practice, until one of these viruses causes extensive disease in people, much expenditure is unlikely

…

Sampath, chief scientist at FIND, a non-profit in Geneva that promotes diagnostics development, it can tell whether it is a hitherto unknown flu, or coronavirus, or a member of other virus families. It was initially sponsored by DARPA, the US defense research agency that (DARPA people always mention) invented the

…

wants surveillance extended to respiratory RNA viruses other than flu, with sampling from around the world, especially in suspected hotspots. They want it to include coronaviruses, Nipah and Hendra viruses, and enteroviruses, the most common family of viral infections in humans, which are mostly symptomless or mild—except a few,

…

if so what mutations to watch for. The US National Institute of Allergy and Infectious Diseases decided last year to renew funding for studies of coronaviruses at the Wuhan Institute of Virology for just that reason. The dilemma is always that doing the experiments without very tight containment might create the

…

theories suggesting Covid-19 does not have a natural origin,” it said. Scientists from many countries had studied it, “and they overwhelmingly conclude that this coronavirus originated in wildlife.” Calling the efforts of China’s scientific community to deal with the outbreak and share their results “remarkable,” they concluded, “We want

…

even though chikungunya, another mosquito-borne virus from Africa, made exactly the same trip in 2013. When virologists in Wuhan and North Carolina found bat coronaviruses that made mice sick and easily infected human cells in 2013, they practically shouted about the pandemic concerns this raised. Scientists also did that in

…

virus much like Covid-19 in bats and warned of its pandemic potential, but that didn’t nudge research agencies to fund renewed work on coronavirus vaccines. The 2008 market crash—itself a textbook product of complexity and tight coupling in the global financial system—triggered government cuts that tightened health

…

the epidemic grew, thought would happen. Maybe they thought they could keep most cases of the infection safely contained in hospitals. Everyone remembered SARS, another coronavirus, and people with SARS normally didn’t spread the virus until they were quite ill. Secrecy can also become an instinct in authoritarian systems, though

…

were not prepared. Covid-19 was an unnecessary catastrophe: we knew enough to keep people away from bat viruses, to develop drugs and vaccines for coronaviruses, and to set up transparent, truly global surveillance networks for outbreaks of potentially pandemic disease. Such surveillance systems would mean that if an outbreak occurs

…

Susan Rice, petitioned the US government to cooperate with China in fighting Covid-19. “China has much to answer for in its response to the coronavirus: its initial coverup, its continuing lack of transparency,” they wrote. “Notwithstanding this, we the undersigned believe that the logic for cooperation is compelling.” In

…

-mail Archive 20200103.6869668, January 3, 2020. Available at: www.promedmail.org. 7. On January 8th… spread: ProMED-mail, “Undiagnosed pneumonia—China (HU) (05): novel coronavirus identified,” ProMED-mail Archive 20200108.6877694, January 8, 2020. Available at: www.promedmail.org. 8. “critical public… wrong”: Jeremy Farrar, Twitter Post, January 10, 2020

…

, 9:50 AM, twitter.com/JeremyFarrar/status/1215647022893670401. 9. The Shanghai… spawned SARS: Zhuang Pinghui, “Chinese laboratory that first shared coronavirus genome with world ordered to close for ‘rectification,’ hindering its Covid-19 research,” South China Morning Post, February 28, 2020, www.scmp.com/news/china

…

/society/article/3052966/chinese-laboratory-first-shared-coronavirus-genome-world-ordered. 10. On January 7th… the virus: Andrew Rambaut, “Preliminary phylogenetic analysis of 11 nCoV2019 genomes, 2020-01-19,” Virological, virological.org/t

…

/preliminary-phylogenetic-analysis-of-11-ncov2019-genomes-2020-01-19/329. 11. The Shanghai lab… next day: Zhuang Pinghui, “Chinese laboratory that first shared coronavirus genome with world ordered to close for ‘rectification,’ hindering its Covid-19 research.” 12. In January, they… go to the hospital: Natsuko Imai, et

…

al., “Report 1—Estimating the potential total number of novel Coronavirus (2019-nCoV) cases in Wuhan City, China,” MRC Centre for Global Infectious Disease Analysis, January 17, 2020, www.imperial.ac.uk/mrc-global-infectious-disease

…

(January 2020): 514–23, doi.org/10.1016/s0140-6736(20)30154-9. 14. On January 15th… sustained human-to-human transmission: ProMED-mail, “Novel coronavirus (05): China (HU), Japan ex China,” ProMED-mail Archive 20200115.6891515, January 15, 2020. Available at: www.promedmail.org. 15. On January 18th… served:

…

cover-up,” Financial Times, February 6, 2020, www.ft.com/content/fa83463a-4737-11ea-aeb3-955839e06441. 17. Then a local… correct here: ProMED-mail, “Novel coronavirus (07): China (HU), Thailand ex China, Japan ex China, WHO,” ProMED-mail Archive 20200117.6895647, January 17, 2020. Available at: www.promedmail.org. 18.

…

By January 20th… climbing: ProMED-mail, “Novel coronavirus (11): China (HU), South Korea ex China,” ProMED-mail Archive 20200120.6899007, January 20, 2020. Available at: www.promedmail.org. 19. Also on… people: Caixin

…

wuhan-whistle. 28. Back in December… department: Translation by Elisabeth Bik, “Dr. Ai Fen, 艾芬, the Wuhan Whistle.” 29. The news… censored: Kynge, Yu, and Hancock, “Coronavirus: the cost of China’s public health cover-up.” 30. The hospital told… alarm: Translation by Elisabeth Bik, “Dr. Ai Fen, 艾芬, the Wuhan Whistle.” 31

…

. The Japanese… rumors: Keisuke Kawazu, “Public backlash over China gov’t accusations against docs who sounded coronavirus alarm,” The Mainchi, January 31, 2020, mainichi.jp/english/articles/20200131/p2a/00m/0in/021000c. 32. And, that day… YY: Lotus Ruan, Jeffrey Knockel, and

…

Masashi Crete-Nishihata, “Censored contagion: how information on the coronavirus is managed on Chinese social media,” The Citizen Lab (University of Toronto), March 3, 2020, citizenlab.ca/2020/03/censored-contagion-how-information-on-the

…

, “China created a fail-safe system to track contagions. It failed,” New York Times, March 29, 2020, www.nytimes.com/2020/03/29/world/asia/coronavirus-china.html. 36. more people… down stairs: Phil Hammond, Twitter Post, January 24, 2020, 3:10 AM, twitter.com/drphilhammond/status/1220619993408266241. 37. Using…

…

case infected: Matt J Keeling, et al., “The efficacy of contact tracing for the containment of the 2019 novel coronavirus (COVID-19),” medRxiv preprint, February 17, 2020, doi.org/10.1101/2020.02.14.20023036. 38. Rosalind… symptoms: Joel Hellewell, et al., “Feasibility of

…

2020, www.facebook.com/watch/?v=1284271178628870. 41. At the end… nearly half: Benjamin J. Cowling, et al., “Impact Assessment of Non-Pharmaceutical Interventions against Coronavirus Disease 2019 and Influenza in Hong Kong: an Observational Study,” The Lancet Public Health 5, no. 5 (April 2020), doi.org/10.1016/s2468-2667

…

0447, February 20, 2003. Available at: www.promedmail.org. 6. Both viruses… inflammation: Meredith Wadman, Jennifer Couzin-Frankel, Jocelyn Kaiser, and Catherine Matacic, “How does coronavirus kill? Clinicians trace a ferocious rampage through the body, from brain to toes,” Science, April 17, 2020, www.sciencemag.org/news/2020/04/how-does

…

. If no action… strain: Nanshan Zhong and Guangqiao Zeng, “What we have learnt from SARS epidemics in China.” 16. he discovered… ProMED: ProMED-mail, “Novel coronavirus—Saudi Arabia: human isolate,” ProMED-mail Archive 20120920.1302733, September 20, 2012. Available at: www.promedmail.org. 17. Within days… Jeddah: Debora MacKenzie, “Threatwatch:

…

bird-flu-research-findings. 19. There was… February 2020: Cissy Zhou, “China reports outbreak of deadly bird flu among chickens in Hunan province, close to coronavirus epicentre of Wuhan,” South China Morning Post, February 2, 2020, www.scmp.com/news/china/society/article/3048566/china-reports-outbreak-deadly-bird-flu-among

…

.gov/grants/guide/notice-files/NOT-OD-17-071.html. 26. In 2019, NIAID… human cells: Peter Daszak (EcoHealth Alliance), “Understanding the risk of bat coronavirus emergence,” Project Number: 2R01AI110964-06, NIH Research Portfolio Online Reporting Tools (RePORT), projectreporter.nih.gov/project_info_description.cfm?aid=9819304&icde=49645421. 27. EcoHealth

…

org/10.1016/j.vaccine.2016.08.019. 26. Bill Gates… discarded: Isobel Asher Hamilton, “Bill Gates is helping fund new factories for 7 potential coronavirus vaccines, even though it will waste billions of dollars,” Business Insider, April 3, 2020, www.businessinsider.com/bill-gates-factories-7-different-vaccines-to-fight

…

stockpile-he-built-1269954. 34. Guaranteeing that right… standard: International Labour Organization (UN), COVID-19 and the world of work,” www.ilo.org/global/topics/coronavirus/impacts-and-responses/WCMS_739049/lang--en/index.htm 35. The GPMB… $53 billion: Caroline Huber, et al., “The economic and social burden of the

…

The Journal of Infectious Diseases 218, supplement 5 (October 2018), doi.org/10.1093/infdis/jiy213. 36. cancer deaths… hospitals: Denis Campbell and Caroline Bannock, “Coronavirus crisis could lead to 18,000 more cancer deaths, experts warn,” Guardian, April 28, 2020, www.theguardian.com/society/2020/apr/29/extra-18000-cancer

…

-ordination let virus spread—UN’s Guterres,” Television newscast, Interview by Nick Bryant, May 1, 2020, www.bbc.com/news/av/world-us-canada-52496983/coronavirus-lack-of-co-ordination-let-virus-spread-un-s-guterres. 24. But that… average incomes: Shannon K. O’Neill, “How to pandemic-proof globalization,”

…

.S. tried to build a new fleet of ventilators. The mission failed,” New York Times, March 29, 2020, www.nytimes.com/2020/03/29/business/coronavirus-us-ventilator-shortage.html. 8. certainly not… valid claim: Kristian Andersen, “nCoV-2019 codon usage and reservoir (not snakes v2),” Virological, January 24, 2020,

…

and-reservoir-not-snakes-v2/339. 9. Zhengli Shi… sequenced: Jane Qiu, “How China’s ‘Bat Woman’ Hunted Down Viruses from SARS to the New Coronavirus,” Scientific American, April 27, 2020, www.scientificamerican.com/article/how-chinas-bat-woman-hunted-down-viruses-from-sars-to-the-new-coronavirus1. 10. Covid-19

…

has a $2.5 trillion problem. Here’s how to solve it,” New York Times, April 20, 2020, www.nytimes.com/2020/04/20/opinion/coronavirus-economy-bailout.html. 30. Besides our biological… infection: Mark Schaller, “The behavioural immune system and the psychology of human sociality,” Philosophical Transactions of the Royal

The Plague Year: America in the Time of Covid

by Lawrence Wright  · 7 Jun 2021  · 391pp  · 112,312 words

start to go haywire. At the top of the list of dangerous pathogens are the respiratory viruses, including novel influenzas, orthopoxviruses (such as smallpox), and coronaviruses. The playbook outlines the conditions under which various government agencies should be enlisted. With domestic outbreaks, the playbook specifies that “[w]hile States hold significant

…

team declared that they had established “clinical proof of concept for structure-based vaccine design,” portending “an era of precision vaccinology.” * * * — In 2012, the MERS coronavirus emerged in Saudi Arabia. Humans initially caught it from camels—perhaps in the slaughterhouse or by drinking camel’s milk. MERS was unstable and terribly

…

got the sequences Friday night, the tenth of January,” Graham recalled. “We woke up on the eleventh and started designing proteins.” Nine days later, the coronavirus officially arrived in America. * * * — Graham and McLellan designed the modified proteins within a day after downloading the sequence for SARS-CoV-2. The key accelerating

…

patients, half of whom received hydroxychloroquine and the other half a placebo. “Within a matter of six days, the patients taking hydroxychloroquine tested negative for coronavirus…the patients that took the control tested positive.” “That’s a game changer,” Ingraham declared. Apparently, Rigano and Todaro got the inspiration to write about

…

news, Trump asked him to lead a campaign to “defeat despair,” which would encourage celebrities to endorse the administration’s laissez-faire approach to the coronavirus. Well-known personalities were vetted to determine their political views. It was discouraging work. Justin Timberlake “publicly endorsed Obama and supports gay marriage.” Scarlett Johansson

…

—those for whites. The vast differences in outcomes among the states underscore the absence of a national plan. Seattle, the first city struck by the coronavirus, wound up with the lowest death rate among large metropolitan areas. Despite its rigorous restrictions on public gatherings and business openings, Washington state’s economy

…

of the Chinese Communist Party and the World Health Organization,” House Foreign Affairs Committee Minority Staff Interim Report, June 12, 2020. “damage stability”: Kristin Huang, “Coronavirus: Wuhan doctor says officials muzzled her for sharing report on WeChat,” South China Morning Post, March 11, 2020. Debora MacKenzie, COVID-19, op. cit., p

…

,” Congressional Research Service, May 13, 2020. “If something happens”: Renwu interview with Dr. Ai Fen. Translated by Mollie Saltskog. “If I had known:” Lily Kuo, “Coronavirus: Wuhan doctor speaks out against the authorities,” Guardian, Mar. 11, 2020. “severely disturbed”: Congressional Research Service, “COVID-19 and China,” May 13, 2020. His punishment

…

. 21, 2020. “How can the bulletins”: Congressional Research Service: COVID-19 and China, May 13, 2020. forced reporters into detention: Vivian Wang, “They Documented the Coronavirus Crises in Wuhan. Then They Vanished,” New York Times, Feb. 14, 2020. hospital authorities again: Jingqi Gong, “Whistleblower,” Renwu, March 10, 2020. highly inventive dissidents

…

: Masha Borak, “Censored coronavirus news shows up again as emoji, Morse code and ancient Chinese,” Abacus, March 12, 2020. destroy existing stock: Zhuang Pinghui, “China confirms unauthorised labs were

…

told to destroy early coronavirus samples,” South China Morning Post, May 15, 2020. “rectification”: Congressional Research Service: COVID-19 and China, May 13, 2020. duplicity of local officials: Edward Wong

…

China Hid Dangers From Beijing, U.S. Agencies Find,” New York Times, Aug. 19, 2020, updated Sept. 17, 2020. demanded that researchers: “China delayed releasing coronavirus info, frustrating WHO,” Associated Press, June 1, 2020. by a couple of weeks: off the record interview with FDA authorities. revised to 3,869: “Wuhan

…

of Information Control,” The New Yorker, Feb. 7, 2020. Not until then: Debora MacKenzie, COVID-19, op cit., p. 17. about 650 million people: “IntelBrief: Coronavirus Continues to Spread Amid Growing Criticism of China,” The Soufan Center, Feb. 20, 2020. nearly three billion trips: Karla Cripps and Serenitie Wang, “World’s

…

Robert Redfield. no clear evidence of human-to-human: Julian Borger, “Caught in a superpower struggle: the inside story of the WHO’s response to coronavirus,” The Guardian, Apr. 18, 2020. no invitation: Interview with Matthew Pottinger. world’s largest reporting system: Li Wang, Zhihao Wang, Qinglian Ma, Guixia Fang,

…

2020,” Clinical Infectious Diseases, Nov. 30, 2020. “I think we’re too late”: Interview with Robert Redfield. “It’s one person”: Dan Mangan, “Trump dismissed coronavirus pandemic worry in January—now claims he long warned about it,” CNBC, Mar. 17, 2020. “no doubt”: Gerard Gallagher, Infectious Disease News, Jan. 11, 2017

…

20, 2020. A German study: Valentina O. Puntmann, M. Ludovica Carej, and Imke Wieters, “Outcomes of Cardiovascular Magnetic Resonance Imaging in Patients Recently Recovered From Coronavirus Disease 2019 (COVID-19),” JAMA, July 27, 2020. 3. SPIKE horse farms: Interview with Barney Graham. not Covid-19: Stacy Kuebelbeck Paulsen, “Study finds no

…

. “We are prepared”: Meeting notes supplied by Senator Patty Murray’s office. “isn’t something the American people”: Warren Fiske, “Fact-check: Did Fauci say coronavirus was ‘nothing to worry about’?” PolitiFact.com, April 29, 2020. “Reactivating these machines”: Katz, Marshall & Banks, LLP, “Addendum to the Complaint of Prohibited Practice and

…

. Mulvaney barred him: Interview with Peter Navarro. also tested positive: Isaac Ghinai, et al., “First known person-to-person transmission of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in the USA,” The Lancet, March 13, 2020. Three major U.S. carriers: Michael Corkery and Annie Karni, “Trump Administration Restricts

…

26, 2020. abnormalities in 78: Valentina O. Puntmann, M. Ludovica Carej, and Imke Wieters, “Outcomes of Cardiovascular Magnetic Resonance Imaging in Patients Recently Recovered From Coronavirus Disease 2019 (COVID-19),” JAMA, July 27, 2020. heart transplants: Jennifer Couzin-Frankel, “As evidence builds that COVID-19 can damage the heart, doctors are

…

. 277; and interview with Matt Pottinger. “Oh, oh, I got”: David Lipson, “Donald Trump’s address was meant to lay out US plans to tackle coronavirus. Instead it sparked confusion,” ABC News, March 13, 2020. “We are marshaling”: trumpwhitehouse.archives.gov/​briefings-statements/​remarks-president-trump-address-nation/ “When Keynes saw

…

.8 billion: “2018-2019 Broadway End-of-Season Statistics,” The Broadway League, May 28, 2020. 10. “IT’S LIKE A WIND” just eclipsed China: “Italy Coronavirus Deaths Rise by 919, Highest Daily Tally Since Start of Outbreak,” Reuters, March 27, 2020. biological warfare: Philip Ziegler, The Black Death, HarperCollins edition, 1971

…

, Bellevue, op. cit., p. 9. only thirty-two tests: Interview with Dr. Matt McCarthy. using their phones: Richard Levitan, “The Infection That’s Silently Killing Coronavirus Patients,” New York Times, April 20, 2020. eight hundred people a day: Interview with Deanne Criswell. storing bodies: Katie Shepherd, “As New York morgues ran

…

,” Washington Post, April 30, 2020. 12. THE NO PLAN PLAN “tremendous control”: Danile Dale, “Fact check: Trump falsely claims US has ‘tremendous control’ of the coronavirus,” CNN, March 15, 2020. “We’re marshalling”: Jonathan Martin, “Trump to Governors on Ventilators: ‘Try Getting It Yourselves,’ ” New York Times, March 16, 2020. “That

…

Amid U.S. Shortage,” Bloomberg, March 17, 2020. least popular governors: Morning Consult, undated. “If you were hoping”: “Governor Cuomo Shuts Down NYC Due To Coronavirus,” YouTube, March 16, 2020. “This could be catastrophic”: Larry Hogan, “Fighting alone,” Washington Post, July 16, 2020. “redirected”: Joel Rose, “A ‘War’ For Medical Suppllies

…

Miami firefighters, rescue officials say,” Associated Press, April 24, 2020. An order of thermometers: Noam N. Levey, “Hospitals say feds are seizing masks and other coronavirus supplies without a word,” Los Angeles Times, April 7, 2020. “I spent hours”: Michael Grunwald, “How the Smallest State Engineered a Big Covid Comeback,” Politico

…

, In Kushnerland, Turned Whistleblower,” The New Yorker, Sept. 21, 2020. “VIP Update”: Jack Elsom, “Whistleblower claims Jared Kushner’s ‘frat-party’ PPE task force hampered coronavirus response,” MailOnline, May 6, 2020; Peter Baker, Maggie Haberman, Zolan Kanno-Youngs, and Noah Weiland, “Kushner Puts Himself in Middle of White House’s Chaotic

…

million: Mark Maremont, “FEMA Cancels $55.5 Million Contract With Panthera,” Wall Street Journal, May 12, 2020. “These volunteers”: Yasmeen Abutaleb and Ashley Parker, “Kushner coronavirus effort said to be hampered by inexperienced volunteers,” Washington Post, May 5, 2020. yearlong contract: Aaron C. Davis, “In the early days of the pandemic

…

, 2020. “I used to have koi”: Libby Cathey, “Timeline: Tracking Trump alongside scientific developments on hydroxychloroquine,” ABC News, Aug. 8, 2020. “serious cardiac adverse events”: “Coronavirus (COVID-19) Update: FDA Revokes Emergency Use Authorization for Chloroquine and Hydroxychloroquine,” FDA News Release, June 15, 2020. twice as likely: Libby Cathey, “Timeline: Tracking

…

? The Importance of Exposure to Innovation,” The Equality of Opportunity Project. 20,000 confirmed cases: Taylor DesOrmeau, “Michigan becomes 3d state to eclipse 20,000 coronavirus cases, Mlive, Apr. 8, 2020. 15. THE MAN WITHOUT A MASK when masks were worn: “Considerations for Wearing Masks,” CDC, updated Dec. 18, 2020. two

…

prsident’s real red line,” Politico, July 7, 2019. “I had a man”: trumpwhitehouse.archives.gov/​briefings-statements/​remarks-president-trump-vice-president-pence-members-coronavirus-task-force-press-conference/​. “politically correct”: John T. Bennett, “ ‘You want to be politically correct’: Trump asks reporter to take mask off then mocks him

…

San Quentin State Prison When They Transferred Medically Vulnerable Incarcerated Persons From the California Institution for Men Without Taking Proper Safeguards,” Feb. 1, 2021. largest coronavirus outbreaks: Zoe Schiffer and Nicole Wetsman, “ ‘They’re Trying to Kill Us,’ ” The Verge, Aug. 28, 2020. 188 percent of capacity: Juan Moreno Haines, “ ‘Man

…

Lisa D. Cook. 19. THELMA AND LOUISE “So, supposedly we hit the body”: “President Trump asks about using ultraviolet light and injecting disinfectants to treat coronavirus,” CNBC, April 23, 2020; “White House task force briefing,” April 23, 2020. “safe return”: “Pediatricians, Educators and Superintendents Urge a Safe Return to Schools This

…

Fall,” press release, American Academy of Pediatrics, July 10, 2020. “herd immunity”: “Fewer than 1 in 10 Americans have antibodies to coronavirus, study finds,” Stanford Medicine press release, Sept. 28, 2020. Sweden would experience: Christie Aschwanden: “The false promise of herd immunity for COVID-19,” Nature, Oct

…

.archives.gov/​briefings-statements/​remarks-president-trump-meeting-governor-ducey-arizona/​. “absolutely the oldest”: “COVID-19 UPDATE: Gov. Justice hosts Dr. Deborah Birx, White House Coronavirus Response Coordinator, to discuss West Virginia virus response,” press release, Office of the Governor Jim Justice., Aug. 19, 2020. sat on Birx’s report: Chris

…

as DeWine’s Chief Health Adviser,” WYSO, Aug. 6, 2020. “medical dictator”: Griff Witte, “Ohio’s Amy Acton inspires admiration, and a blacklash, with tough coronavirus response,” Washington Post, May 18, 2020. twenty-seven top health officials: Jackie Borchardt and Jessie Balmert, “First came the pandemic, then came the politics: Why

…

Dangerous Gain-of-Function Experiments in Influenza?” Influenza Virus, Aug. 28, 2018. “virus infectivity experiments”: George Arbuthnott, Jonathan Calvert, and Philip Sherwell, “Revealed: Seven year coronavirus trail from mine deaths to a Wuhan lab,” The Sunday Times, July 4, 2020. “a serious shortage”: Josh Rogin, “State Department cables warned of safety

…

Warned of Risky Cornoavirus Experiments in a Wuhan Lab. No One Listened,” Politico, March 8, 2021. “high degree of confidence”: Jeff Mason, “Trump confident that coronavirus may have originated in Chinese lab,” Reuters, April 30, 2020. “President Trump’s claim”: Jon Cohen, “Trump ‘owes us an apology.’ Chinese scientist at the

…

Intelligence, “Intelligence Community Statement on Origins of COVID-19,” April 30, 2020. “Nature created this virus”: Zachary Brennan, “NIH director: ‘No way of knowing’ if coronavirus escaped from Wuhan lab,” Politico, May 27, 2020. “The CREID network”: “NIAID Establishes Centers for Research in Emerging Infectious Diseases,” NIAID press release, Aug. 27

…

-19 origins in China: Tedros,” Reuters, March 30, 2021. several bats taken: Supaporn Wacharapluesadee, Chee Wah Tan, et al., “Evidence for SARS-CoV-2 related coronaviruses circulating in bats and pangolins in Southeast Asia,” Nature Communications, Feb. 9, 2021. wildlife farms: Michaeleen Doucleff, “WHO Points to Wildlife Farms in Southern China

…

Chinese netizens continue to honor Li Wenliang, COVID-19, whistleblower,” SupChina, March 31, 2020; Emily Feng, “Dear Dr. Li: Chinese Netizens Confess To The Late Coronavirus Whistleblower,” NPR, Feb. 7, 2021. “Dr. Li did”: “Remarks by Deputy National Security Advisor Matt Pottinger to the Miller Center at the University of Virginia

…

Quilantan, and Gabrielle Wanneh, “Which States had the best pandemic response?” Politico, Oct. 14, 2020. death rate per 100,000: Johns Hopkins University of Medicine, Coronavirus Resource Center. life expectancy: Sabrina Tavrnise and Abby Goodnough, “A Grim Measure of Covid’s Toll: Life Expectancy Drops Sharply in U.S.,” New York

…

spike mutants from global SARS-CoV-2 variants,” bioRxiv preprint, Jan. 25, 2021. began designing boosters: Carolyn Y. Johnson, Laurie McGinley, and Joel Achenbach, “New coronavirus variants accelerate race to make sure vaccines keep up, Washington Post, Jan. 25, 2021. In the Bronx Zoo: “Update: Bronx Zoo Tigers and Lions Recovering

Pandemic, Inc.: Chasing the Capitalists and Thieves Who Got Rich While We Got Sick

by J. David McSwane  · 11 Apr 2022  · 368pp  · 102,379 words

of each item requested. Officials overseeing the stockpile were already safeguarding precious inventory and were, in essence, winging it. Pence, now overseeing the White House Coronavirus Task Force, said in a press conference that day that the federal government was working with 3M to speed up production of N95s by tens

…

last night of February 2020, Kadlec read through a scientific analysis published by Chinese scientists titled: “The epidemiological characteristics of an outbreak of 2019 novel coronavirus diseases in China.” It provided some of the first scientifically rigorous conclusions and was a harbinger of the devastation to come. The study examined more

…

switched gears for what amounted to a less emotionally taxing but foundational journalistic pursuit—following the money. On March 27, Trump signed into law the Coronavirus Aid, Relief, and Economic Security Act. The CARES Act unleashed $2.2 trillion in stimulus relief and spending. Among many initiatives, it authorized rare

…

In the data we’d find former telemarketers whose records included allegations of fraud, but who were now entrusted with delivering millions of masks and coronavirus test tubes. Dozens of the companies we plucked out had been created just days before landing multimillion-dollar contracts. It appeared that anyone who paid

…

pressed for answers from FEMA and added the Fillakit contract to a growing stack of inquiries taken up by the House Select Subcommittee on the Coronavirus Response. The inspector general of homeland security launched its own inquiry. FEMA cited that ongoing investigation when it denied ProPublica’s request for records

…

really was: obstinacy and hatred masquerading as individual liberty and patriotism. In high definition, we saw that America was sickened by far more than a coronavirus. Many who perpetuated the “Stop the Steal” movement, alleging the 2020 election had been stolen from Trump, were also prominent beneficiaries of the anti-

…

Burden’ on the U.S.’s Troubled Stockpile,” New York Times, March 6, 2021, https://www.nytimes.com/2021/03/06/us/emergent-biosolutions-anthrax-coronavirus.html. but because of poor oversight Patricia Callahan and Sebastian Rotella, “Taxpayers Paid Millions to Design a Low-Cost Ventilator for a Pandemic. Instead, the

…

Burden’ on the U.S.’s Troubled Stockpile,” New York Times, March 6, 2021, https://www.nytimes.com/2021/03/06/us/emergent-biosolutions-anthrax-coronavirus.html. “Reduction could result in fewer people” “Departments of Labor, Health and Human Services, Education, and Related Agencies Appropriations for 2014,” Hearings Before a

…

Far about Covid-19 in the Seattle Area, Washington State and the Nation,” Seattle Times, June 11, 2020, https://www.seattletimes.com/seattle-news/health/coronavirus-kirkland-seattle-updates-tuesday/. fifty residents and staff showing symptoms Oscar Jimenez and Julia Jones, “A Nursing Home in the Seattle Area Is at the

…

Labor & Pensions,” March 3, 2020, https://www.help.senate.gov/hearings/an-emerging-disease-threat-how-the-us-is-responding-to-covid-19-the-novel-coronavirus. Burr was something of a pandemic expert “President Signs Into Law Senator Burr’s Legislation to Defend Nation from Pandemics and Bioterrorism,” Richard Burr for

…

“Richard Burr and Other Senators Sold Lots of Stock as Virus Fears Started,” CBS News, March 20, 2020, https://www.cbsnews.com/news/richard-burr-coronavirus-kelly-loeffler-dianne-feinstein-james-inhofe-sold-lots-of-stock-virus-fears-started/. Senator Mitt Romney, Republican of Utah “An Emerging Disease Threat: How the

…

“Trump to Governors on Ventilators: ‘Try Getting It Yourselves,’ ” New York Times, March 16, 2020, https://www.nytimes.com/2020/03/16/us/politics/trump-coronavirus-respirators.html. That very day, emails show, the commissioner Texas Department of State Health Services, “DSHS Urges Providers to Order Additional COVID-19 Vaccine as

…

Holland, “White House–Led Airlift of Urgently Needed Medical Supplies Arrives in New York,” Reuters, March 29, 2020, https://www.reuters.com/article/us-health-coronavirus-trump-airlift/white-house-led-airlift-of-urgently-needed-medical-supplies-arrives-in-new-york-idUSKBN21G0LB. “At President Trump’s direction” Ibid. states with governors

…

New Scrutiny as Some of His Pandemic Moves Unravel,” Washington Post, September 2, 2020, https://www.washingtonpost.com/us-policy/2020/09/02/navarro-pandemic-coronavirus/. He’s been described Alan Rappeport, “Peter Navarro Invented an Expert for His Books, Based on Himself,” New York Times, October 16, 2019. https://

…

to Xavier Becerra. a consultant helping Phlow Ibid. Hatfill was given office space “Clyburn Issues Subpoena to Trump White House Advisor Dr. Steven Hatfill on Coronavirus Response,” House Committee on Oversight and Reform, September 23, 2021, https://oversight.house.gov/news/press-releases/clyburn-issues-subpoena-to-trump-white-house-advisor

…

COVID-19-Response.html. The next week, the parent company’s stock price McSwane and Torbati, “The White House Pushed FEMA to Give Its Biggest Coronavirus Contract to a Company That Never Had to Bid.” The company would almost triple McSwane, “Documents Show Trump Officials Skirted Rules to Reward Politically Connected

…

Stripper in Atlanta or a Native American Medicine Woman” “It’s like stumbling into the drug business” J. David McSwane, “The Secret, Absurd World of Coronavirus Mask Traders and Middlemen Trying to Get Rich off Government Money,” ProPublica, June 1, 2020, https://www.propublica.org/article/the-secret-absurd-world-of

…

government-money. 12. How to Make Millions Selling Masks, in Three Easy Steps! A few hours earlier J. David McSwane, “The Secret, Absurd World of Coronavirus Mask Traders and Middlemen Trying to Get Rich off Government Money,” ProPublica, June 1, 2020, https://www.propublica.org/article/the-secret-absurd-world-of

…

Services Submitted by Dr. Rick Bright (Washington, DC: Katz, Marshall & Banks LLP, 2020). Bright leaked information and emails Ibid. The 1918 influenza Eric Adler, “A Coronavirus Lesson? How KC’s Response to 1918 Flu Pandemic Caused Needless Death,” Kansas City Star, March 17, 2020, https://www.kansascity.com/news/business/health

…

Path of Least Resistance Has Led Texas to the Brink of Disaster,” Texas Monthly, July 17, 2020, https://www.texasmonthly.com/news-politics/greg-abbott-coronavirus-disaster/. He chose instead to leave Lauren McGaughy, “Bathroom Showdown: Legislative Leaders Square Off over ‘Bathroom Bill,’ Threaten Special Session,” Dallas News, August 25, 2019

…

com/news/us-news/texas-lt-gov-dan-patrick-suggests-he-other-seniors-willing-n1167341. His order superseded any local ordinance Philip Jankowski, “Abbott’s Coronavirus Order Nixes Austin’s Enforcement of Face Mask Mandate,” Austin American-Statesman, April 27, 2020, https://www.statesman.com/story/news/local/flash-briefing/2020

…

/04/27/abbotts-coronavirus-order-nixes-austins-enforcement-of-face-mask-mandate/1280470007/. In late April, Patrick used the Fox News bullhorn Alex Samuels, “Dan Patrick Says ‘There Are

…

Things than Living and That’s Saving This Country,’ ” Texas Tribune, April 21, 2020, https://www.texastribune.org/2020/04/21/texas-dan-patrick-economy-coronavirus/. reporters at the Daily Beast Olivia Messer, “Texas Governor Admits Dangers of Reopening State on Private Call with Lawmakers,” Daily Beast, May 6, 2020,

…

a Wingman like Dan Patrick, Who Needs Critics?” Texas Tribune, July 2, 2020, https://www.texastribune.org/2020/07/02/dan-patrick-greg-abbott-texas-coronavirus/. Luther, by now a famous and formidable critic Catherine Marfin, “Salon Owner Shelley Luther Announces Run for Texas Senate Seat,” Dallas News, August 22,

…

Florida: What You Need to Know Monday, July 6,” Fort Myers News-Press, July 6, 2020, http17s://www.news-press.com/story/news/coronavirus/2020/07/06/florida-coronavirus-cases-deaths-hospitalizations/5382351002/. After his indictment HINA, “American Film Producer Don Victor Cisternino Ends Up in Remetinic Jail,” Total Croatia News, April

…

Gave Richest Clients ‘Concierge Treatment’ for Pandemic Aid,” New York Times, April 23, 2020, https://www.nytimes.com/2020/04/22/business/sba-loans-ppp-coronavirus.html?action=click&module=Top+Stories&pgtype=Homepage. The nation’s largest bank Ibid. By mid-April 2020 Danielle Kurtzleben, “Small Business Emergency

…

than $395 billion Moiz Syed and Derek Willis, “Tracking PPP: Search Every Company Approved for Federal Loans,” ProPublica, July 7, 2020, https://projects.propublica.org/coronavirus/bailouts/. The company popped up Ibid. 18. Dazed and Confused She had spent years ambling about Kristen Gould Case, “Local Color,” Park City Magazine, October

…

, “Joseph Mercola Is the Most Influential Spreader of COVID-19 Misinformation Online, Researchers Say,” Baltimore Sun, July 25, 2021, https://www.baltimoresun.com/coronavirus/ct-aud-nw-nyt-coronavirus-misinformation-mercola-20210725-amteliewy5dihmi6ntjnc3b4sa-story.html. marketed and sold expensive tanning beds Janssen, “Accused by Feds, Sun Bed–Selling Doctor Settles for up

…

Charlene Bollinger Michelle R. Smith, “Inside One Network Cashing In on Vaccine Disinformation,” Associated Press, May 13, 2021, https://apnews.com/article/anti-vaccine-bollinger-coronavirus-disinformation-a7b8e1f33990670563b4c469b462c9bf. The couple claims to have sold Ibid. Sayer Ji and Kelly Brogan Pandemic Profiteers. Brogan claims to be a practitioner Dean Sterling Jones

…

’s Health Defense Moiz Syed and Derek Willis, “Tracking PPP: Search Every Company Approved for Federal Loans,” ProPublica, July 7, 2020, https://projects.propublica.org/coronavirus/bailouts/. The Bollingers applied for loans Ibid. Brogan and her husband Ibid. 20. Underlying Conditions Colorado State University asked me “Webinar Series: CSU Grads on

…

. 21. “Capitalism, Baby” By emulating spike proteins “Understanding mRNA COVID-19 Vaccines,” Centers for Disease Control and Prevention, November 3, 2021, https://www.cdc.gov/coronavirus/2019-ncov/vaccines/different-vaccines/mrna.html. If scientists could tell cells Damian Garde, Jonathan Saltzman, Robert J. Walczak, Arlete A. M. Coelho-Castelo, László

…

1002/cpt.2344. They realized that their synthetic mRNA Ibid. Eventually they proved they could induce Kolata, “Kati Kariko Helped Shield the World from the Coronavirus.” Could the same process be used Ibid. They patented their method Mario Gaviria and Burcu Kilic, “A Network Analysis of COVID-19 mRNA Vaccine Patents

…

-listings-of-all-time. a more modest $150 million Garde et al., “The Story of mRNA.” As soon as scientists in China “China Delayed Releasing Coronavirus Info, Frustrating WHO,” Associated Press, June 2, 2020, https://apnews.com/article/united-nations-health-ap-top-news-virus-outbreak-public-health-3c061794970661042b18d5aeaaed9fae. Unlike other

…

, 2020, https://www.cnn.com/factsfirst/politics/factcheck_565aa63a-4c46-4eea-9586-093253d1bdf3. Moderna managed to design its vaccine “Moderna Ships mRNA Vaccine Against Novel Coronavirus (mRNA-1273) for Phase 1 Study,” Moderna press release, February 24, 2020, https://investors.modernatx.com/news-releases/news-release-details/moderna-ships-mrna-vaccine

…

-against-novel-coronavirus-mrna-1273. it would become one of the top beneficiaries Miriam Valverde, “How Pfizer’s and Moderna’s COVID-19 Vaccines Are Tied to Operation

…

80 of his fellow residents COVID-19 Long-Term Care Facilities Data for Pennsylvania, Pennsylvania Department of Health, https://www.health.pa.gov/topics/disease/coronavirus/Pages/LTCF-Data.aspx, accessed December 2, 2021. More than 400 of them, including Gill Ibid. Almost one in every three Americans “State Covid-

…

19 Data and Policy Actions,” KFF, December 2, 2021, https://www.kff.org/coronavirus-covid-19/issue-brief/state-covid-19-data-and-policy-actions/#longtermcare. “death pits” Farah Stockman, Matt Richtel, Danielle Ivory, and Mitch Smith, “ ‘They’re

…

, the Pennsylvania Department of Health COVID-19 Long-Term Care Facilities Data for Pennsylvania, Pennsylvania Department of Health, https://www.health.pa.gov/topics/disease/coronavirus/Pages/LTCF-Data.aspx, accessed December 2, 2021. On March 22 Daveen Rae Kurutz, “Brighton Rehab Medical Director Sounded Alarm on PPE, Testing Needs

…

in Late March,” Beaver County Times, April 1, 2020, https://www.timesonline.com/story/news/coronavirus/2020/04/01/brighton-rehab-medical-director-sounded/1419409007/. hydroxychloroquine, which the president had been touting Sean D. Hamill, “State Report: Brighton Knew It Didn

…

Say That Would Be ‘Worst-Case Scenario,’ ” CBS Pittsburgh, April 16, 2020, https://pittsburgh.cbslocal.com/2020/04/16/bradys-run-park-ice-arena-refrozen-coronavirus-bodies/. By the second week of May Sean D. Hamill, “National Guard Arrives to Help Beaver County Nursing Home Battling Covid-19 Outbreak,” Pittsburgh Post

…

as Daily Covid Deaths Drop to Lowest Point in More than a Year,” ABC13 Houston, KTRK-TV, June 26, 2021. https://abc13.com/covid19-vaccine-coronavirus-numbers-texas-how-many-texans-are-vaccinated-hospitalizations/10834845/. ripping through a Texas prison Katie Camero, “Covid Outbreak in Texas Prison Reveals Delta Variant’s

…

Wrath. Did Vaccines Help?,” Fort Worth Star Telegram, September 22, 2021, https://www.star-telegram.com/news/coronavirus/article254435113.html. Kansans of the year “2020 Distinguished Kansans Worked to Help Others in Difficult Year,” Topeka Capital-Journal, December 31, 2020, https://www.cjonline

…

Columbus, Georgia, 103, 107 Comcast, 135 Commerce Department, 46 Comprehensive Healthcare Management Services LLC, 246, 247–248 Congressional Budget Office, 20 conspiracy theorists, 219, 223 coronavirus. See also COVID-19 (era of) article published by Chinese scientists on, 43 cases in U.S., March 2020, 59 in China, early 2000s, 20

…

, 71 repackaging masks to be sold to, 156–169 supply chain issues and, 29 VA, 117 House Appropriations Committee, 16 House Select Subcommittee on the Coronavirus Response, 191 House Ways and Means Committee, 42 Houston, Texas, 160, 162, 166, 182, 183, 186 Hutchinson, Kansas, 146, 260–261 hydrogen peroxide, as

…

, 32 belated action by, 8 Bowen, Mike on, 32 CARES Act and, 86 conference call with governors, 50 conspiracist ideologies during, 219 downplaying threat of coronavirus, 39, 41 hydroxychloroquine and, 123 January 6th insurrection and, 227–228 misleading the public, 42 Navarro, Peter and, 31, 80 Navarro’s memo to,

The Viral Underclass: The Human Toll When Inequality and Disease Collide

by Steven W. Thrasher  · 1 Aug 2022  · 361pp  · 110,233 words

The Survival of the City: Human Flourishing in an Age of Isolation

by Edward Glaeser and David Cutler  · 14 Sep 2021  · 735pp  · 165,375 words

Spike: The Virus vs The People - The Inside Story

by Jeremy Farrar and Anjana Ahuja  · 15 Jan 2021  · 245pp  · 71,886 words

Uncontrolled Spread: Why COVID-19 Crushed Us and How We Can Defeat the Next Pandemic

by Scott Gottlieb  · 20 Sep 2021

A Shot to Save the World: The Inside Story of the Life-Or-Death Race for a COVID-19 Vaccine

by Gregory Zuckerman  · 25 Oct 2021  · 368pp  · 106,185 words

In Covid's Wake: How Our Politics Failed Us

by Stephen Macedo and Frances Lee  · 10 Mar 2025  · 393pp  · 146,371 words

Duty of Care: One NHS Doctor's Story of the Covid-19 Crisis

by Dr Dominic Pimenta  · 2 Sep 2020  · 304pp  · 95,306 words

The Lonely Century: How Isolation Imperils Our Future

by Noreena Hertz  · 13 May 2020  · 506pp  · 133,134 words

Breathtaking: Inside the NHS in a Time of Pandemic

by Rachel Clarke  · 26 Jan 2021  · 199pp  · 63,844 words

Ten Lessons for a Post-Pandemic World

by Fareed Zakaria  · 5 Oct 2020  · 289pp  · 86,165 words

Merchants of the Right: Gun Sellers and the Crisis of American Democracy

by Jennifer Carlson  · 2 May 2023  · 279pp  · 100,877 words

Longshot

by David Heath  · 18 Jan 2022

How to Talk to a Science Denier: Conversations With Flat Earthers, Climate Deniers, and Others Who Defy Reason

by Lee McIntyre  · 14 Sep 2021  · 407pp  · 108,030 words

Limitless: The Federal Reserve Takes on a New Age of Crisis

by Jeanna Smialek  · 27 Feb 2023  · 601pp  · 135,202 words

Vaxxers: The Inside Story of the Oxford AstraZeneca Vaccine and the Race Against the Virus

by Sarah Gilbert and Catherine Green  · 7 Jul 2021  · 296pp  · 96,568 words

Essential: How the Pandemic Transformed the Long Fight for Worker Justice

by Jamie K. McCallum  · 15 Nov 2022  · 349pp  · 99,230 words

Deadly Quiet City: True Stories From Wuhan

by Murong Xuecun  · 7 Mar 2023  · 236pp  · 73,008 words

Border and Rule: Global Migration, Capitalism, and the Rise of Racist Nationalism

by Harsha Walia  · 9 Feb 2021

Reset

by Ronald J. Deibert  · 14 Aug 2020

The New Map: Energy, Climate, and the Clash of Nations

by Daniel Yergin  · 14 Sep 2020

Tenants: The People on the Frontline of Britain's Housing Emergency

by Vicky Spratt  · 18 May 2022  · 371pp  · 122,273 words

Trillion Dollar Triage: How Jay Powell and the Fed Battled a President and a Pandemic---And Prevented Economic Disaster

by Nick Timiraos  · 1 Mar 2022  · 357pp  · 107,984 words

Risk: A User's Guide

by Stanley McChrystal and Anna Butrico  · 4 Oct 2021  · 489pp  · 106,008 words

The Dying Citizen: How Progressive Elites, Tribalism, and Globalization Are Destroying the Idea of America

by Victor Davis Hanson  · 15 Nov 2021  · 458pp  · 132,912 words

Covid by Numbers

by David Spiegelhalter and Anthony Masters  · 28 Oct 2021

The Controlled Demolition of the American Empire

by Jeff Berwick and Charlie Robinson  · 14 Apr 2020  · 491pp  · 141,690 words

How the World Ran Out of Everything

by Peter S. Goodman  · 11 Jun 2024  · 528pp  · 127,605 words

COVID-19: Everything You Need to Know About the Corona Virus and the Race for the Vaccine

by Michael Mosley  · 1 Jun 2020  · 89pp  · 27,057 words

Spillover: Animal Infections and the Next Human Pandemic

by David Quammen  · 30 Sep 2012  · 669pp  · 195,743 words

How to Prevent the Next Pandemic

by Bill Gates  · 2 May 2022  · 406pp  · 88,977 words

The COVID-19 Catastrophe: What's Gone Wrong and How to Stop It Happening Again

by Richard Horton  · 31 May 2020  · 106pp  · 33,210 words

Them and Us: How Immigrants and Locals Can Thrive Together

by Philippe Legrain  · 14 Oct 2020  · 521pp  · 110,286 words

The Lords of Easy Money: How the Federal Reserve Broke the American Economy

by Christopher Leonard  · 11 Jan 2022  · 416pp  · 124,469 words

The Miracle Pill

by Peter Walker  · 21 Jan 2021  · 372pp  · 98,659 words

Rule of the Robots: How Artificial Intelligence Will Transform Everything

by Martin Ford  · 13 Sep 2021  · 288pp  · 86,995 words

The Wires of War: Technology and the Global Struggle for Power

by Jacob Helberg  · 11 Oct 2021  · 521pp  · 118,183 words

The Day the World Stops Shopping

by J. B. MacKinnon  · 14 May 2021  · 368pp  · 109,432 words

The Premonition: A Pandemic Story

by Michael Lewis  · 3 May 2021  · 285pp  · 98,832 words

The Pandemic Century: One Hundred Years of Panic, Hysteria, and Hubris

by Mark Honigsbaum  · 8 Apr 2019  · 529pp  · 150,263 words

Investing to Save the Planet: How Your Money Can Make a Difference

by Alice Ross  · 19 Nov 2020  · 197pp  · 53,831 words

Fulfillment: Winning and Losing in One-Click America

by Alec MacGillis  · 16 Mar 2021  · 426pp  · 136,925 words

The Wake-Up Call: Why the Pandemic Has Exposed the Weakness of the West, and How to Fix It

by John Micklethwait and Adrian Wooldridge  · 1 Sep 2020  · 134pp  · 41,085 words

Imaginable: How to See the Future Coming and Feel Ready for Anything―Even Things That Seem Impossible Today

by Jane McGonigal  · 22 Mar 2022  · 420pp  · 135,569 words

Nothing Personal: My Secret Life in the Dating App Inferno

by Nancy Jo Sales  · 17 May 2021  · 445pp  · 135,648 words

J.K. Lasser's Your Income Tax 2022: For Preparing Your 2021 Tax Return

by J. K. Lasser Institute  · 21 Dec 2021

The Bill Gates Problem: Reckoning With the Myth of the Good Billionaire

by Tim Schwab  · 13 Nov 2023  · 618pp  · 179,407 words

Arriving Today: From Factory to Front Door -- Why Everything Has Changed About How and What We Buy

by Christopher Mims  · 13 Sep 2021  · 385pp  · 112,842 words

The Corona Crash: How the Pandemic Will Change Capitalism

by Grace Blakeley  · 14 Oct 2020  · 82pp  · 24,150 words

The Hype Machine: How Social Media Disrupts Our Elections, Our Economy, and Our Health--And How We Must Adapt

by Sinan Aral  · 14 Sep 2020  · 475pp  · 134,707 words

Forward: Notes on the Future of Our Democracy

by Andrew Yang  · 15 Nov 2021

Other Pandemic: How QAnon Contaminated the World

by James Ball  · 19 Jul 2023  · 317pp  · 87,048 words

How to Spend a Trillion Dollars

by Rowan Hooper  · 15 Jan 2020  · 285pp  · 86,858 words

There Is Nothing for You Here: Finding Opportunity in the Twenty-First Century

by Fiona Hill  · 4 Oct 2021  · 569pp  · 165,510 words

The Dream of Europe: Travels in the Twenty-First Century

by Geert Mak  · 27 Oct 2021  · 722pp  · 223,701 words

Brexit Unfolded: How No One Got What They Want (And Why They Were Never Going To)

by Chris Grey  · 22 Jun 2021  · 334pp  · 91,722 words

The Data Detective: Ten Easy Rules to Make Sense of Statistics

by Tim Harford  · 2 Feb 2021  · 428pp  · 103,544 words

The Land of Hope and Fear: Israel's Battle for Its Inner Soul

by Isabel Kershner  · 16 May 2023  · 472pp  · 145,476 words

Dangerous Ideas: A Brief History of Censorship in the West, From the Ancients to Fake News

by Eric Berkowitz  · 3 May 2021  · 412pp  · 115,048 words

Empireland: How Imperialism Has Shaped Modern Britain

by Sathnam Sanghera  · 28 Jan 2021  · 430pp  · 111,038 words

Seven Crashes: The Economic Crises That Shaped Globalization

by Harold James  · 15 Jan 2023  · 469pp  · 137,880 words

Vulture Capitalism: Corporate Crimes, Backdoor Bailouts, and the Death of Freedom

by Grace Blakeley  · 11 Mar 2024  · 371pp  · 137,268 words

News and How to Use It: What to Believe in a Fake News World

by Alan Rusbridger  · 26 Nov 2020  · 371pp  · 109,320 words

Fed Up!: Success, Excess and Crisis Through the Eyes of a Hedge Fund Macro Trader

by Colin Lancaster  · 3 May 2021  · 245pp  · 75,397 words

Stakeholder Capitalism: A Global Economy That Works for Progress, People and Planet

by Klaus Schwab and Peter Vanham  · 27 Jan 2021  · 460pp  · 107,454 words

The Future of Money: How the Digital Revolution Is Transforming Currencies and Finance

by Eswar S. Prasad  · 27 Sep 2021  · 661pp  · 185,701 words

Stakeholder Capitalism: A Global Economy That Works for Progress, People and Planet

by Klaus Schwab  · 7 Jan 2021  · 460pp  · 107,454 words

The War Below: Lithium, Copper, and the Global Battle to Power Our Lives

by Ernest Scheyder  · 30 Jan 2024  · 355pp  · 133,726 words

Beyond Inheritance: Our Ever-Mutating Cells and a New Understanding of Health

by Roxanne Khamsi;  · 21 Apr 2026  · 335pp  · 91,958 words

Chaos Kings: How Wall Street Traders Make Billions in the New Age of Crisis

by Scott Patterson  · 5 Jun 2023  · 289pp  · 95,046 words

Work Won't Love You Back: How Devotion to Our Jobs Keeps Us Exploited, Exhausted, and Alone

by Sarah Jaffe  · 26 Jan 2021  · 490pp  · 153,455 words

Four Battlegrounds

by Paul Scharre  · 18 Jan 2023

Amazon Unbound: Jeff Bezos and the Invention of a Global Empire

by Brad Stone  · 10 May 2021  · 569pp  · 156,139 words

The World for Sale: Money, Power and the Traders Who Barter the Earth’s Resources

by Javier Blas and Jack Farchy  · 25 Feb 2021  · 565pp  · 134,138 words

Life on the Rocks: Building a Future for Coral Reefs

by Juli Berwald  · 4 Apr 2022  · 495pp  · 114,451 words

The Stolen Year

by Anya Kamenetz  · 23 Aug 2022  · 347pp  · 103,518 words

Poverty for Profit

by Anne Kim  · 384pp  · 112,825 words

Hype: How Scammers, Grifters, and Con Artists Are Taking Over the Internet―and Why We're Following

by Gabrielle Bluestone  · 5 Apr 2021  · 329pp  · 100,162 words

Abundance

by Ezra Klein and Derek Thompson  · 18 Mar 2025  · 227pp  · 84,566 words

Viruses: A Very Short Introduction (Very Short Introductions)

by Crawford, Dorothy H.  · 27 Jul 2011  · 161pp  · 37,042 words

Binge Times: Inside Hollywood's Furious Billion-Dollar Battle to Take Down Netflix

by Dade Hayes and Dawn Chmielewski  · 18 Apr 2022  · 414pp  · 117,581 words

Cabin Fever: The Harrowing Journey of a Cruise Ship at the Dawn of a Pandemic

by Michael Smith and Jonathan Franklin  · 14 Jul 2022  · 244pp  · 78,238 words

Digital Empires: The Global Battle to Regulate Technology

by Anu Bradford  · 25 Sep 2023  · 898pp  · 236,779 words

The Quiet Damage: QAnon and the Destruction of the American Family

by Jesselyn Cook  · 22 Jul 2024  · 321pp  · 95,778 words

The Long Game: China's Grand Strategy to Displace American Order

by Rush Doshi  · 24 Jun 2021  · 816pp  · 191,889 words

Revenge of the Tipping Point: Overstories, Superspreaders, and the Rise of Social Engineering

by Malcolm Gladwell  · 1 Oct 2024  · 283pp  · 85,644 words

Exponential: How Accelerating Technology Is Leaving Us Behind and What to Do About It

by Azeem Azhar  · 6 Sep 2021  · 447pp  · 111,991 words

Sandy Hook: An American Tragedy and the Battle for Truth

by Elizabeth Williamson  · 8 Mar 2022  · 574pp  · 148,233 words

Editing Humanity: The CRISPR Revolution and the New Era of Genome Editing

by Kevin Davies  · 5 Oct 2020  · 741pp  · 164,057 words

The Chaos Machine: The Inside Story of How Social Media Rewired Our Minds and Our World

by Max Fisher  · 5 Sep 2022  · 439pp  · 131,081 words

The Great Wave: The Era of Radical Disruption and the Rise of the Outsider

by Michiko Kakutani  · 20 Feb 2024  · 262pp  · 69,328 words

The Contrarian: Peter Thiel and Silicon Valley's Pursuit of Power

by Max Chafkin  · 14 Sep 2021  · 524pp  · 130,909 words

Shape: The Hidden Geometry of Information, Biology, Strategy, Democracy, and Everything Else

by Jordan Ellenberg  · 14 May 2021  · 665pp  · 159,350 words

This Land: The Struggle for the Left

by Owen Jones  · 23 Sep 2020  · 387pp  · 123,237 words

Sunbelt Blues: The Failure of American Housing

by Andrew Ross  · 25 Oct 2021  · 301pp  · 90,276 words

The Tyranny of Merit: What’s Become of the Common Good?

by Michael J. Sandel  · 9 Sep 2020  · 493pp  · 98,982 words

The Perfect Police State: An Undercover Odyssey Into China's Terrifying Surveillance Dystopia of the Future

by Geoffrey Cain  · 28 Jun 2021  · 340pp  · 90,674 words

Everyday Utopia: What 2,000 Years of Wild Experiments Can Teach Us About the Good Life

by Kristen R. Ghodsee  · 16 May 2023  · 302pp  · 112,390 words

El Paso: Five Families and One Hundred Years of Blood, Migration, Race, and Memory

by Jazmine Ulloa  · 3 Mar 2026  · 395pp  · 116,052 words

Our Lives in Their Portfolios: Why Asset Managers Own the World

by Brett Chistophers  · 25 Apr 2023  · 404pp  · 106,233 words

The Wisdom of Crowds

by James Surowiecki  · 1 Jan 2004  · 326pp  · 106,053 words

The New Nomads: How the Migration Revolution Is Making the World a Better Place

by Felix Marquardt  · 7 Jul 2021  · 250pp  · 75,151 words

The Atlas of Disease

by Sandra Hempel  · 15 Sep 2018

Paved Paradise: How Parking Explains the World

by Henry Grabar  · 8 May 2023  · 413pp  · 115,274 words

How to Read Numbers: A Guide to Statistics in the News (And Knowing When to Trust Them)

by Tom Chivers and David Chivers  · 18 Mar 2021  · 172pp  · 51,837 words

AI 2041: Ten Visions for Our Future

by Kai-Fu Lee and Qiufan Chen  · 13 Sep 2021

We're Not Broken: Changing the Autism Conversation

by Eric Garcia  · 2 Aug 2021  · 398pp  · 96,909 words

Billionaire, Nerd, Savior, King: Bill Gates and His Quest to Shape Our World

by Anupreeta Das  · 12 Aug 2024  · 315pp  · 115,894 words

How Boards Work: And How They Can Work Better in a Chaotic World

by Dambisa Moyo  · 3 May 2021  · 272pp  · 76,154 words

Battle for the Bird: Jack Dorsey, Elon Musk, and the $44 Billion Fight for Twitter's Soul

by Kurt Wagner  · 20 Feb 2024  · 332pp  · 127,754 words

Please Don't Sit on My Bed in Your Outside Clothes: Essays

by Phoebe Robinson  · 14 Oct 2021  · 265pp  · 93,354 words

Lost at Sea: Poverty and Paradise Collide at the Edge of America

by Joe Kloc  · 14 Apr 2025  · 249pp  · 71,929 words

How to Work Without Losing Your Mind

by Cate Sevilla  · 14 Jan 2021

Trading at the Speed of Light: How Ultrafast Algorithms Are Transforming Financial Markets

by Donald MacKenzie  · 24 May 2021  · 400pp  · 121,988 words

Tomorrow's Capitalist: My Search for the Soul of Business

by Alan Murray  · 15 Dec 2022  · 263pp  · 77,786 words

This Book Could Fix Your Life: The Science of Self Help

by New Scientist and Helen Thomson  · 7 Jan 2021  · 442pp  · 85,640 words

The London Problem: What Britain Gets Wrong About Its Capital City

by Jack Brown  · 14 Jul 2021  · 101pp  · 24,949 words

The Identity Trap: A Story of Ideas and Power in Our Time

by Yascha Mounk  · 26 Sep 2023

Survival of the Richest: Escape Fantasies of the Tech Billionaires

by Douglas Rushkoff  · 7 Sep 2022  · 205pp  · 61,903 words

Open: The Story of Human Progress

by Johan Norberg  · 14 Sep 2020  · 505pp  · 138,917 words

American Marxism

by Mark R. Levin  · 12 Jul 2021  · 314pp  · 88,524 words

Less Is More: How Degrowth Will Save the World

by Jason Hickel  · 12 Aug 2020  · 286pp  · 87,168 words

Evil Geniuses: The Unmaking of America: A Recent History

by Kurt Andersen  · 14 Sep 2020  · 486pp  · 150,849 words

The Story of Work: A New History of Humankind

by Jan Lucassen  · 26 Jul 2021  · 869pp  · 239,167 words

The Mutant Project: Inside the Global Race to Genetically Modify Humans

by Eben Kirksey  · 10 Nov 2020  · 599pp  · 98,564 words

You've Been Played: How Corporations, Governments, and Schools Use Games to Control Us All

by Adrian Hon  · 14 Sep 2022  · 371pp  · 107,141 words

How Medicine Works and When It Doesn't: Learning Who to Trust to Get and Stay Healthy

by F. Perry Wilson  · 24 Jan 2023  · 286pp  · 92,521 words

Moon Prague, Vienna & Budapest: Palaces & Castles, Art & Music, Coffeehouses & Beer Gardens

by Jennifer D Walker, Auburn Scallon and Moon Travel Guides  · 15 Oct 2024  · 806pp  · 221,571 words

Buy Now, Pay Later: The Extraordinary Story of Afterpay

by Jonathan Shapiro and James Eyers  · 2 Aug 2021  · 444pp  · 124,631 words

Summer of Our Discontent: The Age of Certainty and the Demise of Discourse

by Thomas Chatterton Williams  · 4 Aug 2025  · 242pp  · 76,315 words

May Contain Lies: How Stories, Statistics, and Studies Exploit Our Biases—And What We Can Do About It

by Alex Edmans  · 13 May 2024  · 315pp  · 87,035 words

Shocks, Crises, and False Alarms: How to Assess True Macroeconomic Risk

by Philipp Carlsson-Szlezak and Paul Swartz  · 8 Jul 2024  · 259pp  · 89,637 words

The Authoritarian Moment: How the Left Weaponized America's Institutions Against Dissent

by Ben Shapiro  · 26 Jul 2021  · 309pp  · 81,243 words

The Information State: Politics in the Age of Total Control

by Jacob Siegel  · 24 Mar 2026  · 348pp  · 103,246 words

Carmageddon: How Cars Make Life Worse and What to Do About It

by Daniel Knowles  · 27 Mar 2023  · 278pp  · 91,332 words

Ageless: The New Science of Getting Older Without Getting Old

by Andrew Steele  · 24 Dec 2020  · 399pp  · 118,576 words

Woke, Inc: Inside Corporate America's Social Justice Scam

by Vivek Ramaswamy  · 16 Aug 2021  · 344pp  · 104,522 words

Among the Braves: Hope, Struggle, and Exile in the Battle for Hong Kong and the Future of Global Democracy

by Shibani Mahtani and Timothy McLaughlin  · 7 Nov 2023  · 348pp  · 110,533 words

Human Frontiers: The Future of Big Ideas in an Age of Small Thinking

by Michael Bhaskar  · 2 Nov 2021

A Hacker's Mind: How the Powerful Bend Society's Rules, and How to Bend Them Back

by Bruce Schneier  · 7 Feb 2023  · 306pp  · 82,909 words

On the Edge: The Art of Risking Everything

by Nate Silver  · 12 Aug 2024  · 848pp  · 227,015 words

The Price of Life: In Search of What We're Worth and Who Decides

by Jenny Kleeman  · 13 Mar 2024  · 334pp  · 96,342 words

The Singularity Is Nearer: When We Merge with AI

by Ray Kurzweil  · 25 Jun 2024

This Is How They Tell Me the World Ends: The Cyberweapons Arms Race

by Nicole Perlroth  · 9 Feb 2021  · 651pp  · 186,130 words

Framers: Human Advantage in an Age of Technology and Turmoil

by Kenneth Cukier, Viktor Mayer-Schönberger and Francis de Véricourt  · 10 May 2021  · 291pp  · 80,068 words

New Laws of Robotics: Defending Human Expertise in the Age of AI

by Frank Pasquale  · 14 May 2020  · 1,172pp  · 114,305 words

The Great Post Office Scandal: The Fight to Expose a Multimillion Pound Scandal Which Put Innocent People in Jail

by Nick Wallis  · 18 Nov 2021  · 705pp  · 192,650 words

Nobody's Fool: Why We Get Taken in and What We Can Do About It

by Daniel Simons and Christopher Chabris  · 10 Jul 2023  · 338pp  · 104,815 words

Practical Doomsday: A User's Guide to the End of the World

by Michal Zalewski  · 11 Jan 2022  · 337pp  · 96,666 words

Culture Warlords: My Journey Into the Dark Web of White Supremacy

by Talia Lavin  · 14 Jul 2020  · 231pp  · 71,299 words

Off the Edge: Flat Earthers, Conspiracy Culture, and Why People Will Believe Anything

by Kelly Weill  · 22 Feb 2022

Raising Lazarus: Hope, Justice, and the Future of America’s Overdose Crisis

by Beth Macy  · 15 Aug 2022  · 389pp  · 111,372 words

Spies, Lies, and Algorithms: The History and Future of American Intelligence

by Amy B. Zegart  · 6 Nov 2021

The Raging 2020s: Companies, Countries, People - and the Fight for Our Future

by Alec Ross  · 13 Sep 2021  · 363pp  · 109,077 words

The Chairman's Lounge: The inside story of how Qantas sold us out

by Joe Aston  · 27 Oct 2024  · 362pp  · 130,141 words

Four Thousand Weeks: Time Management for Mortals

by Oliver Burkeman  · 9 Aug 2021  · 206pp  · 68,757 words

Cogs and Monsters: What Economics Is, and What It Should Be

by Diane Coyle  · 11 Oct 2021  · 305pp  · 75,697 words

Welcome to Britain: Fixing Our Broken Immigration System

by Colin Yeo;  · 15 Feb 2020  · 393pp  · 102,801 words

The Great Demographic Reversal: Ageing Societies, Waning Inequality, and an Inflation Revival

by Charles Goodhart and Manoj Pradhan  · 8 Aug 2020  · 438pp  · 84,256 words

The Powerful and the Damned: Private Diaries in Turbulent Times

by Lionel Barber  · 5 Nov 2020

Decoding the World: A Roadmap for the Questioner

by Po Bronson  · 14 Jul 2020  · 320pp  · 95,629 words

Sickening: How Big Pharma Broke American Health Care and How We Can Repair It

by John Abramson  · 15 Dec 2022  · 362pp  · 97,473 words

Who’s Raising the Kids?: Big Tech, Big Business, and the Lives of Children

by Susan Linn  · 12 Sep 2022  · 415pp  · 102,982 words

Wasteland: The Dirty Truth About What We Throw Away, Where It Goes, and Why It Matters

by Oliver Franklin-Wallis  · 21 Jun 2023  · 309pp  · 121,279 words

The Price Is Wrong: Why Capitalism Won't Save the Planet

by Brett Christophers  · 12 Mar 2024  · 557pp  · 154,324 words

Remote Work Revolution: Succeeding From Anywhere

by Tsedal Neeley  · 14 Oct 2021  · 223pp  · 60,936 words

A Brief History of Motion: From the Wheel, to the Car, to What Comes Next

by Tom Standage  · 16 Aug 2021  · 290pp  · 85,847 words

The Impossible City: A Hong Kong Memoir

by Karen Cheung  · 15 Feb 2022  · 297pp  · 96,945 words

This Is Not Normal: The Collapse of Liberal Britain

by William Davies  · 28 Sep 2020  · 210pp  · 65,833 words

Capitalism and Its Critics: A History: From the Industrial Revolution to AI

by John Cassidy  · 12 May 2025  · 774pp  · 238,244 words

There Is No Place for Us: Working and Homeless in America

by Brian Goldstone  · 25 Mar 2025  · 512pp  · 153,059 words

No One Succeeds Alone

by Robert Reffkin  · 4 May 2021  · 210pp  · 62,278 words

San Fransicko: Why Progressives Ruin Cities

by Michael Shellenberger  · 11 Oct 2021  · 572pp  · 124,222 words

The Great Influenza: The Story of the Deadliest Pandemic in History

by John M. Barry  · 9 Feb 2004  · 667pp  · 186,968 words

Caste: The Origins of Our Discontents

by Isabel Wilkerson  · 14 Sep 2020  · 470pp  · 137,882 words

The Politics Industry: How Political Innovation Can Break Partisan Gridlock and Save Our Democracy

by Katherine M. Gehl and Michael E. Porter  · 14 Sep 2020  · 627pp  · 89,295 words

The Nowhere Office: Reinventing Work and the Workplace of the Future

by Julia Hobsbawm  · 11 Apr 2022  · 172pp  · 50,777 words

Doppelganger: A Trip Into the Mirror World

by Naomi Klein  · 11 Sep 2023

Happy-Go-Lucky

by David Sedaris  · 30 May 2022  · 206pp  · 64,212 words

The Heat Will Kill You First: Life and Death on a Scorched Planet

by Jeff Goodell  · 10 Jul 2023  · 347pp  · 108,323 words

Laziness Does Not Exist

by Devon Price  · 5 Jan 2021  · 362pp  · 87,462 words

The Power Law: Venture Capital and the Making of the New Future

by Sebastian Mallaby  · 1 Feb 2022  · 935pp  · 197,338 words

The Pyramid of Lies: Lex Greensill and the Billion-Dollar Scandal

by Duncan Mavin  · 20 Jul 2022  · 345pp  · 100,989 words

The Rise and Fall of the Neoliberal Order: America and the World in the Free Market Era

by Gary Gerstle  · 14 Oct 2022  · 655pp  · 156,367 words

The Ransomware Hunting Team: A Band of Misfits' Improbable Crusade to Save the World From Cybercrime

by Renee Dudley and Daniel Golden  · 24 Oct 2022  · 392pp  · 114,189 words

Code Dependent: Living in the Shadow of AI

by Madhumita Murgia  · 20 Mar 2024  · 336pp  · 91,806 words

Bootstrapped: Liberating Ourselves From the American Dream

by Alissa Quart  · 14 Mar 2023  · 304pp  · 86,028 words

Vassal State

by Angus Hanton  · 25 Mar 2024  · 277pp  · 81,718 words

On Breathing

by Jamieson Webster  · 20 Feb 2025  · 198pp  · 63,059 words

Chokepoints: American Power in the Age of Economic Warfare

by Edward Fishman  · 25 Feb 2025  · 884pp  · 221,861 words

Trumpocalypse: Restoring American Democracy

by David Frum  · 25 May 2020  · 319pp  · 75,257 words

Lessons from the Titans: What Companies in the New Economy Can Learn from the Great Industrial Giants to Drive Sustainable Success

by Scott Davis, Carter Copeland and Rob Wertheimer  · 13 Jul 2020  · 372pp  · 101,678 words

The Loop: How Technology Is Creating a World Without Choices and How to Fight Back

by Jacob Ward  · 25 Jan 2022  · 292pp  · 94,660 words

Power Play: Tesla, Elon Musk, and the Bet of the Century

by Tim Higgins  · 2 Aug 2021  · 430pp  · 135,418 words

Unthinkable: Trauma, Truth, and the Trials of American Democracy

by Jamie Raskin  · 4 Jan 2022  · 450pp  · 144,939 words

The Fund: Ray Dalio, Bridgewater Associates, and the Unraveling of a Wall Street Legend

by Rob Copeland  · 7 Nov 2023  · 412pp  · 122,655 words

Inventor of the Future: The Visionary Life of Buckminster Fuller

by Alec Nevala-Lee  · 1 Aug 2022  · 864pp  · 222,565 words

Like, Comment, Subscribe: Inside YouTube's Chaotic Rise to World Domination

by Mark Bergen  · 5 Sep 2022  · 642pp  · 141,888 words

Owning the Sun

by Alexander Zaitchik  · 7 Jan 2022  · 341pp  · 98,954 words

SEDATED: How Modern Capitalism Created Our Mental Health Crisis

by James. Davies  · 15 Nov 2021  · 307pp  · 88,085 words

Aiming High: Masayoshi Son, SoftBank, and Disrupting Silicon Valley

by Atsuo Inoue  · 18 Nov 2021  · 295pp  · 89,441 words

Power, for All: How It Really Works and Why It's Everyone's Business

by Julie Battilana and Tiziana Casciaro  · 30 Aug 2021  · 345pp  · 92,063 words

The Constitution of Knowledge: A Defense of Truth

by Jonathan Rauch  · 21 Jun 2021  · 446pp  · 109,157 words

As Gods: A Moral History of the Genetic Age

by Matthew Cobb  · 15 Nov 2022  · 772pp  · 150,109 words

Sparks: China's Underground Historians and Their Battle for the Future

by Ian Johnson  · 26 Sep 2023  · 407pp  · 119,073 words

When McKinsey Comes to Town: The Hidden Influence of the World's Most Powerful Consulting Firm

by Walt Bogdanich and Michael Forsythe  · 3 Oct 2022  · 689pp  · 134,457 words

System Error: Where Big Tech Went Wrong and How We Can Reboot

by Rob Reich, Mehran Sahami and Jeremy M. Weinstein  · 6 Sep 2021

How to Stand Up to a Dictator

by Maria Ressa  · 19 Oct 2022

And Finally

by Henry Marsh  · 167pp  · 57,175 words

Life as We Made It: How 50,000 Years of Human Innovation Refined--And Redefined--Nature

by Beth Shapiro  · 15 Dec 2021  · 338pp  · 105,112 words

Beyond Diversification: What Every Investor Needs to Know About Asset Allocation

by Sebastien Page  · 4 Nov 2020  · 367pp  · 97,136 words

Life's Edge: The Search for What It Means to Be Alive

by Carl Zimmer  · 9 Mar 2021  · 392pp  · 109,945 words

Moon Portugal

by Carrie-Marie Bratley  · 15 Mar 2021  · 743pp  · 193,663 words

I, Warbot: The Dawn of Artificially Intelligent Conflict

by Kenneth Payne  · 16 Jun 2021  · 339pp  · 92,785 words

100 Things We've Lost to the Internet

by Pamela Paul  · 14 Oct 2021  · 194pp  · 54,355 words

Automation and the Future of Work

by Aaron Benanav  · 3 Nov 2020  · 175pp  · 45,815 words

The Geek Way: The Radical Mindset That Drives Extraordinary Results

by Andrew McAfee  · 14 Nov 2023  · 381pp  · 113,173 words

The Great Displacement: Climate Change and the Next American Migration

by Jake Bittle  · 21 Feb 2023  · 296pp  · 118,126 words

Uncomfortably Off: Why the Top 10% of Earners Should Care About Inequality

by Marcos González Hernando and Gerry Mitchell  · 23 May 2023

The Dark Cloud: How the Digital World Is Costing the Earth

by Guillaume Pitron  · 14 Jun 2023  · 271pp  · 79,355 words

Character Limit: How Elon Musk Destroyed Twitter

by Kate Conger and Ryan Mac  · 17 Sep 2024

Growth: A Reckoning

by Daniel Susskind  · 16 Apr 2024  · 358pp  · 109,930 words

Recoding America: Why Government Is Failing in the Digital Age and How We Can Do Better

by Jennifer Pahlka  · 12 Jun 2023  · 288pp  · 96,204 words

Cathedrals of Steam: How London’s Great Stations Were Built – and How They Transformed the City

by Christian Wolmar  · 5 Nov 2020  · 352pp  · 98,424 words

Scary Smart: The Future of Artificial Intelligence and How You Can Save Our World

by Mo Gawdat  · 29 Sep 2021  · 259pp  · 84,261 words

The Cult of We: WeWork, Adam Neumann, and the Great Startup Delusion

by Eliot Brown and Maureen Farrell  · 19 Jul 2021  · 460pp  · 130,820 words

Fancy Bear Goes Phishing: The Dark History of the Information Age, in Five Extraordinary Hacks

by Scott J. Shapiro  · 523pp  · 154,042 words

The Capitalist Manifesto

by Johan Norberg  · 14 Jun 2023  · 295pp  · 87,204 words

How to Avoid a Climate Disaster: The Solutions We Have and the Breakthroughs We Need

by Bill Gates  · 16 Feb 2021  · 314pp  · 75,678 words

An Ugly Truth: Inside Facebook's Battle for Domination

by Sheera Frenkel and Cecilia Kang  · 12 Jul 2021  · 372pp  · 100,947 words

Rich White Men: What It Takes to Uproot the Old Boys' Club and Transform America

by Garrett Neiman  · 19 Jun 2023  · 386pp  · 112,064 words

The Trauma Chronicles

by Westaby, Stephen  · 1 Feb 2023

MegaThreats: Ten Dangerous Trends That Imperil Our Future, and How to Survive Them

by Nouriel Roubini  · 17 Oct 2022  · 328pp  · 96,678 words

Your Face Belongs to Us: A Secretive Startup's Quest to End Privacy as We Know It

by Kashmir Hill  · 19 Sep 2023  · 487pp  · 124,008 words

The Science of Hate: How Prejudice Becomes Hate and What We Can Do to Stop It

by Matthew Williams  · 23 Mar 2021  · 592pp  · 125,186 words

Failed State: The Sunday Times Bestselling Investigation Into Why Britain Is Struggling

by Sam Freedman  · 10 Jul 2024  · 368pp  · 101,133 words

Fear Is Just a Word: A Missing Daughter, a Violent Cartel, and a Mother's Quest for Vengeance

by Azam Ahmed  · 26 Sep 2023  · 483pp  · 129,263 words

A Hunter-Gatherer's Guide to the 21st Century: Evolution and the Challenges of Modern Life

by Heather Heying and Bret Weinstein  · 14 Sep 2021  · 384pp  · 105,110 words

Rationality: What It Is, Why It Seems Scarce, Why It Matters

by Steven Pinker  · 14 Oct 2021  · 533pp  · 125,495 words

Moon Mexico City: Neighborhood Walks, Food & Culture, Beloved Local Spots

by Julie Meade  · 7 Aug 2023  · 527pp  · 131,002 words

What We Owe the Future: A Million-Year View

by William MacAskill  · 31 Aug 2022  · 451pp  · 125,201 words

Fluke: Chance, Chaos, and Why Everything We Do Matters

by Brian Klaas  · 23 Jan 2024  · 250pp  · 96,870 words

The Genetic Lottery: Why DNA Matters for Social Equality

by Kathryn Paige Harden  · 20 Sep 2021  · 375pp  · 102,166 words

Fallen Idols: Twelve Statues That Made History

by Alex von Tunzelmann  · 7 Jul 2021  · 337pp  · 87,236 words

How Big Things Get Done: The Surprising Factors Behind Every Successful Project, From Home Renovations to Space Exploration

by Bent Flyvbjerg and Dan Gardner  · 16 Feb 2023  · 353pp  · 97,029 words

Still Broke: Walmart's Remarkable Transformation and the Limits of Socially Conscious Capitalism

by Rick Wartzman  · 15 Nov 2022  · 215pp  · 69,370 words

Slow Productivity: The Lost Art of Accomplishment Without Burnout

by Cal Newport  · 5 Mar 2024  · 233pp  · 65,893 words

Planes, Trains and Toilet Doors: 50 Places That Changed British Politics

by Matt Chorley  · 8 Feb 2024  · 254pp  · 75,897 words

Super Founders: What Data Reveals About Billion-Dollar Startups

by Ali Tamaseb  · 14 Sep 2021  · 251pp  · 80,831 words

Capital Allocators: How the World’s Elite Money Managers Lead and Invest

by Ted Seides  · 23 Mar 2021  · 199pp  · 48,162 words

100 Years of Identity Crisis: Culture War Over Socialisation

by Frank Furedi  · 6 Sep 2021  · 535pp  · 103,761 words

Trillions: How a Band of Wall Street Renegades Invented the Index Fund and Changed Finance Forever

by Robin Wigglesworth  · 11 Oct 2021  · 432pp  · 106,612 words

Sustainable Minimalism: Embrace Zero Waste, Build Sustainability Habits That Last, and Become a Minimalist Without Sacrificing the Planet (Green Housecleaning, Zero Waste Living)

by Stephanie Marie Seferian  · 19 Jan 2021

Curbing Traffic: The Human Case for Fewer Cars in Our Lives

by Chris Bruntlett and Melissa Bruntlett  · 28 Jun 2021  · 225pp  · 70,590 words

Insight Guides Iceland

by Insight Guides  · 6 Dec 2024  · 415pp  · 110,831 words

Fortune's Bazaar: the Making of Hong Kong: The Making of Hong Kong

by Vaudine England  · 16 May 2023  · 308pp  · 122,100 words

Crack-Up Capitalism: Market Radicals and the Dream of a World Without Democracy

by Quinn Slobodian  · 4 Apr 2023  · 360pp  · 107,124 words

The Revolutionary Center: The Lost Genius of Liberalism

by Adrian Wooldridge  · 7 Apr 2026  · 342pp  · 129,097 words

Apocalypse Never: Why Environmental Alarmism Hurts Us All

by Michael Shellenberger  · 28 Jun 2020

Science Fictions: How Fraud, Bias, Negligence, and Hype Undermine the Search for Truth

by Stuart Ritchie  · 20 Jul 2020

12 Bytes: How We Got Here. Where We Might Go Next

by Jeanette Winterson  · 15 Mar 2021  · 256pp  · 73,068 words

Can We Talk About Israel?: A Guide for the Curious, Confused, and Conflicted

by Daniel Sokatch  · 18 Oct 2021  · 556pp  · 95,955 words

Mine!: How the Hidden Rules of Ownership Control Our Lives

by Michael A. Heller and James Salzman  · 2 Mar 2021  · 332pp  · 100,245 words

Restarting the Future: How to Fix the Intangible Economy

by Jonathan Haskel and Stian Westlake  · 4 Apr 2022  · 338pp  · 85,566 words

The Shame Machine: Who Profits in the New Age of Humiliation

by Cathy O'Neil  · 15 Mar 2022  · 318pp  · 73,713 words

The Emperor's New Road: How China's New Silk Road Is Remaking the World

by Jonathan Hillman  · 28 Sep 2020  · 388pp  · 99,023 words

Power and Progress: Our Thousand-Year Struggle Over Technology and Prosperity

by Daron Acemoglu and Simon Johnson  · 15 May 2023  · 619pp  · 177,548 words

The Pay Off: How Changing the Way We Pay Changes Everything

by Gottfried Leibbrandt and Natasha de Teran  · 14 Jul 2021  · 326pp  · 91,532 words

Nuts and Bolts: Seven Small Inventions That Changed the World (In a Big Way)

by Roma Agrawal  · 2 Mar 2023  · 290pp  · 80,461 words

Age of the City: Why Our Future Will Be Won or Lost Together

by Ian Goldin and Tom Lee-Devlin  · 21 Jun 2023  · 248pp  · 73,689 words

The Coming Wave: Technology, Power, and the Twenty-First Century's Greatest Dilemma

by Mustafa Suleyman  · 4 Sep 2023  · 444pp  · 117,770 words

A Short History of Humanity: How Migration Made Us Who We Are

by Johannes Krause and Thomas Trappe  · 8 Apr 2021  · 218pp  · 62,621 words

Under a White Sky: The Nature of the Future

by Elizabeth Kolbert  · 15 Mar 2021  · 221pp  · 59,755 words

Transport for Humans: Are We Nearly There Yet?

by Pete Dyson and Rory Sutherland  · 15 Jan 2021  · 342pp  · 72,927 words

Dead in the Water: A True Story of Hijacking, Murder, and a Global Maritime Conspiracy

by Matthew Campbell and Kit Chellel  · 2 May 2022  · 363pp  · 98,496 words

Visual Thinking: The Hidden Gifts of People Who Think in Pictures, Patterns, and Abstractions

by Temple Grandin, Ph.d.  · 11 Oct 2022

One Billion Americans: The Case for Thinking Bigger

by Matthew Yglesias  · 14 Sep 2020

The Great Experiment: Why Diverse Democracies Fall Apart and How They Can Endure

by Yascha Mounk  · 19 Apr 2022  · 442pp  · 112,155 words

Chokepoint Capitalism

by Rebecca Giblin and Cory Doctorow  · 26 Sep 2022  · 396pp  · 113,613 words

Not the End of the World

by Hannah Ritchie  · 9 Jan 2024  · 335pp  · 101,992 words

Badvertising

by Andrew Simms  · 314pp  · 81,529 words

Flying Blind: The 737 MAX Tragedy and the Fall of Boeing

by Peter Robison  · 29 Nov 2021  · 382pp  · 105,657 words

Career and Family: Women’s Century-Long Journey Toward Equity

by Claudia Goldin  · 11 Oct 2021  · 445pp  · 122,877 words

Cheap Land Colorado: Off-Gridders at America's Edge

by Ted Conover  · 1 Nov 2022  · 391pp  · 106,255 words

Emotional Labor: The Invisible Work Shaping Our Lives and How to Claim Our Power

by Rose Hackman  · 27 Mar 2023

The Greek Revolution: 1821 and the Making of Modern Europe

by Mark Mazower  · 4 Nov 2021  · 887pp  · 242,125 words

Gambling Man

by Lionel Barber  · 3 Oct 2024  · 424pp  · 123,730 words

Extremely Hardcore: Inside Elon Musk's Twitter

by Zoë Schiffer  · 13 Feb 2024  · 343pp  · 92,693 words

Unit X: How the Pentagon and Silicon Valley Are Transforming the Future of War

by Raj M. Shah and Christopher Kirchhoff  · 8 Jul 2024  · 272pp  · 103,638 words

The Bookshop: A History of the American Bookstore

by Evan Friss  · 5 Aug 2024  · 493pp  · 120,793 words

Palace Coup: The Billionaire Brawl Over the Bankrupt Caesars Gaming Empire

by Sujeet Indap and Max Frumes  · 16 Mar 2021  · 362pp  · 116,497 words

Superbloom: How Technologies of Connection Tear Us Apart

by Nicholas Carr  · 28 Jan 2025  · 231pp  · 85,135 words

Care: The Highest Stage of Capitalism

by Premilla Nadasen  · 10 Oct 2023  · 288pp  · 82,972 words

Hope Dies Last: Visionary People Across the World, Fighting to Find Us a Future

by Alan Weisman  · 21 Apr 2025  · 599pp  · 149,014 words

Spooked: The Trump Dossier, Black Cube, and the Rise of Private Spies

by Barry Meier  · 17 May 2021  · 319pp  · 89,192 words

Lonely Planet Peru

by Lonely Planet  · 1,166pp  · 301,688 words

Empty Vessel: The Story of the Global Economy in One Barge

by Ian Kumekawa  · 6 May 2025  · 422pp  · 112,638 words

Futureproof: 9 Rules for Humans in the Age of Automation

by Kevin Roose  · 9 Mar 2021  · 208pp  · 57,602 words

Midnight in Vehicle City: General Motors, Flint, and the Strike That Created the Middle Class

by Edward McClelland  · 2 Feb 2021  · 264pp  · 74,785 words

Empire of Pain: The Secret History of the Sackler Dynasty

by Patrick Radden Keefe  · 12 Apr 2021  · 712pp  · 212,334 words

GDP: The World’s Most Powerful Formula and Why It Must Now Change

by Ehsan Masood  · 4 Mar 2021  · 303pp  · 74,206 words

Not One Inch: America, Russia, and the Making of Post-Cold War Stalemate

by M. E. Sarotte  · 29 Nov 2021  · 791pp  · 222,536 words

A World on the Wing: The Global Odyssey of Migratory Birds

by Scott Weidensaul  · 29 Mar 2021  · 415pp  · 136,343 words

Jellyfish Age Backwards: Nature's Secrets to Longevity

by Nicklas Brendborg  · 17 Jan 2023  · 222pp  · 68,595 words

The Next Shift: The Fall of Industry and the Rise of Health Care in Rust Belt America

by Gabriel Winant  · 23 Mar 2021  · 563pp  · 136,190 words

More Everything Forever: AI Overlords, Space Empires, and Silicon Valley's Crusade to Control the Fate of Humanity

by Adam Becker  · 14 Jun 2025  · 381pp  · 119,533 words

Mood Machine: The Rise of Spotify and the Costs of the Perfect Playlist

by Liz Pelly  · 7 Jan 2025  · 293pp  · 104,461 words

The Ages of Globalization

by Jeffrey D. Sachs  · 2 Jun 2020

Together

by Vivek H. Murthy, M.D.  · 5 Mar 2020  · 405pp  · 112,470 words

If Then: How Simulmatics Corporation Invented the Future

by Jill Lepore  · 14 Sep 2020  · 467pp  · 149,632 words

Net Zero: How We Stop Causing Climate Change

by Dieter Helm  · 2 Sep 2020  · 304pp  · 90,084 words

Blood and Oil: Mohammed Bin Salman's Ruthless Quest for Global Power

by Bradley Hope and Justin Scheck  · 14 Sep 2020  · 339pp  · 103,546 words

After Steve: How Apple Became a Trillion-Dollar Company and Lost Its Soul

by Tripp Mickle  · 2 May 2022  · 535pp  · 149,752 words

The New Snobbery

by David Skelton  · 28 Jun 2021  · 226pp  · 58,341 words

The Revolution That Wasn't: GameStop, Reddit, and the Fleecing of Small Investors

by Spencer Jakab  · 1 Feb 2022  · 420pp  · 94,064 words

2034: A Novel of the Next World War

by Elliot Ackerman and James Admiral Stavridis  · 15 Mar 2021  · 297pp  · 89,292 words

The Key Man: The True Story of How the Global Elite Was Duped by a Capitalist Fairy Tale

by Simon Clark and Will Louch  · 14 Jul 2021  · 403pp  · 105,550 words

The Crux

by Richard Rumelt  · 27 Apr 2022  · 363pp  · 109,834 words

When More Is Not Better: Overcoming America's Obsession With Economic Efficiency

by Roger L. Martin  · 28 Sep 2020  · 600pp  · 72,502 words

The Star Builders: Nuclear Fusion and the Race to Power the Planet

by Arthur Turrell  · 2 Aug 2021  · 297pp  · 84,447 words

California Burning: The Fall of Pacific Gas and Electric--And What It Means for America's Power Grid

by Katherine Blunt  · 29 Aug 2022  · 470pp  · 107,074 words

Autism After the Pandemic: A Step by Step Guide to Successfully Transition Back to School and Work

by James Ball and Kristie Lofland  · 17 Aug 2020  · 26pp  · 5,240 words

Work: A History of How We Spend Our Time

by James Suzman  · 2 Sep 2020  · 909pp  · 130,170 words

Not Working: Where Have All the Good Jobs Gone?

by David G. Blanchflower  · 12 Apr 2021  · 566pp  · 160,453 words

Women and Other Monsters: Building a New Mythology

by Jess Zimmerman  · 9 Mar 2021  · 224pp  · 74,019 words

Python for Algorithmic Trading: From Idea to Cloud Deployment

by Yves Hilpisch  · 8 Dec 2020  · 1,082pp  · 87,792 words

Cultish: The Language of Fanaticism

by Amanda Montell  · 14 Jun 2021  · 244pp  · 73,700 words

Adriatic: A Concert of Civilizations at the End of the Modern Age

by Robert D. Kaplan  · 11 Apr 2022  · 500pp  · 115,119 words

Elon Musk

by Walter Isaacson  · 11 Sep 2023  · 562pp  · 201,502 words

Numbers Don't Lie: 71 Stories to Help Us Understand the Modern World

by Vaclav Smil  · 4 May 2021  · 252pp  · 60,959 words

Bill Bailey's Remarkable Guide to Happiness: THE FEELGOOD BOOK OF THE YEAR

by Bill Bailey  · 14 Oct 2020  · 112pp  · 34,520 words

Strength in Numbers: How Polls Work and Why We Need Them

by G. Elliott Morris  · 11 Jul 2022  · 252pp  · 71,176 words

Belgium - Culture Smart!: The Essential Guide to Customs & Culture

by Bernadett Varga  · 14 Aug 2022

Death Glitch: How Techno-Solutionism Fails Us in This Life and Beyond

by Tamara Kneese  · 14 Aug 2023  · 284pp  · 75,744 words

The Power of Geography: Ten Maps That Reveal the Future of Our World

by Tim Marshall  · 14 Oct 2021  · 383pp  · 105,387 words

Number Go Up: Inside Crypto's Wild Rise and Staggering Fall

by Zeke Faux  · 11 Sep 2023  · 385pp  · 106,848 words

How Elites Ate the Social Justice Movement

by Fredrik Deboer  · 4 Sep 2023  · 211pp  · 78,547 words

The Elements of Choice: Why the Way We Decide Matters

by Eric J. Johnson  · 12 Oct 2021  · 362pp  · 103,087 words

American Kleptocracy: How the U.S. Created the World's Greatest Money Laundering Scheme in History

by Casey Michel  · 23 Nov 2021  · 466pp  · 116,165 words

Damsel in Distressed: My Life in the Golden Age of Hedge Funds

by Dominique Mielle  · 6 Sep 2021  · 195pp  · 63,455 words

Gilded Rage: Elon Musk and the Radicalization of Silicon Valley

by Jacob Silverman  · 9 Oct 2025  · 312pp  · 103,645 words

Flowers of Fire: The Inside Story of South Korea's Feminist Movement and What It Means for Women's Rights Worldwide

by Hawon Jung  · 21 Mar 2023  · 401pp  · 112,589 words

The War Came to Us: Life and Death in Ukraine

by Christopher Miller  · 17 Jul 2023  · 469pp  · 149,526 words

The Science and Technology of Growing Young: An Insider's Guide to the Breakthroughs That Will Dramatically Extend Our Lifespan . . . And What You Can Do Right Now

by Sergey Young  · 23 Aug 2021  · 326pp  · 88,968 words

Fodor's Essential Israel

by Fodor's Travel Guides  · 2 Aug 2023  · 695pp  · 189,074 words

Strange Sally Diamond: A BBC Between the Covers Book Club Pick

by Liz Nugent  · 2 Mar 2023  · 355pp  · 103,988 words

Who Will Defend Europe?: An Awakened Russia and a Sleeping Continent

by Keir Giles  · 24 Oct 2024  · 296pp  · 81,440 words

The Climate Book: The Facts and the Solutions

by Greta Thunberg  · 14 Feb 2023  · 651pp  · 162,060 words

The Passenger: Paris

by AA.VV.  · 26 Jun 2021  · 199pp  · 62,204 words

The Alternative: How to Build a Just Economy

by Nick Romeo  · 15 Jan 2024  · 343pp  · 103,376 words

Tory Nation: The Dark Legacy of the World's Most Successful Political Party

by Samuel Earle  · 3 May 2023  · 245pp  · 88,158 words

In Search of Now

by Jo Marchant  · 9 Dec 2025  · 365pp  · 105,070 words

Nexus: A Brief History of Information Networks From the Stone Age to AI

by Yuval Noah Harari  · 9 Sep 2024  · 566pp  · 169,013 words

Cities in the Sky: The Quest to Build the World's Tallest Skyscrapers

by Jason M. Barr  · 13 May 2024  · 292pp  · 107,998 words

Samuelson Friedman: The Battle Over the Free Market

by Nicholas Wapshott  · 2 Aug 2021  · 453pp  · 122,586 words

Routes to Rejoin

by Stay European  · 3 Oct 2021  · 940pp  · 16,301 words

Lonely Planet Wales

by Anna Kaminski;Hugh McNaughtan  · 640pp  · 160,013 words

The Equality Machine: Harnessing Digital Technology for a Brighter, More Inclusive Future

by Orly Lobel  · 17 Oct 2022  · 370pp  · 112,809 words

The Undertow: Scenes From a Slow Civil War

by Jeff Sharlet  · 21 Mar 2023  · 308pp  · 97,480 words

The Tyranny of Nostalgia: Half a Century of British Economic Decline

by Russell Jones  · 15 Jan 2023  · 463pp  · 140,499 words

Meditations for Mortals: Four Weeks to Embrace Your Limitations and Make Time for What Counts

by Oliver Burkeman  · 8 Oct 2024  · 123pp  · 43,370 words

Pure Invention: How Japan's Pop Culture Conquered the World

by Matt Alt  · 14 Apr 2020

The Measure of Progress: Counting What Really Matters

by Diane Coyle  · 15 Apr 2025  · 321pp  · 112,477 words

Apple in China: The Capture of the World's Greatest Company

by Patrick McGee  · 13 May 2025  · 377pp  · 138,306 words

Make Your Own Job: How the Entrepreneurial Work Ethic Exhausted America

by Erik Baker  · 13 Jan 2025  · 362pp  · 132,186 words

Making Sense of Chaos: A Better Economics for a Better World

by J. Doyne Farmer  · 24 Apr 2024  · 406pp  · 114,438 words

Boom: Bubbles and the End of Stagnation

by Byrne Hobart and Tobias Huber  · 29 Oct 2024  · 292pp  · 106,826 words

Bad Company

by Megan Greenwell  · 18 Apr 2025  · 385pp  · 103,818 words

The Musical Human: A History of Life on Earth

by Michael Spitzer  · 31 Mar 2021  · 632pp  · 163,143 words

Why Startups Fail: A New Roadmap for Entrepreneurial Success

by Tom Eisenmann  · 29 Mar 2021  · 387pp  · 106,753 words

How I Invest My Money: Finance Experts Reveal How They Save, Spend, and Invest

by Brian Portnoy and Joshua Brown  · 17 Nov 2020  · 149pp  · 43,747 words

It's Better Than It Looks: Reasons for Optimism in an Age of Fear

by Gregg Easterbrook  · 20 Feb 2018  · 424pp  · 119,679 words

The Heart of Business: Leadership Principles for the Next Era of Capitalism

by Hubert Joly  · 14 Jun 2021  · 265pp  · 75,202 words

Israel & the Palestinian Territories Travel Guide

by Lonely Planet

Working Backwards: Insights, Stories, and Secrets From Inside Amazon

by Colin Bryar and Bill Carr  · 9 Feb 2021  · 302pp  · 100,493 words

Snakes and Ladders: The Great British Social Mobility Myth

by Selina Todd  · 11 Feb 2021  · 598pp  · 150,801 words

Alpha Trader

by Brent Donnelly  · 11 May 2021

Kings of Crypto: One Startup's Quest to Take Cryptocurrency Out of Silicon Valley and Onto Wall Street

by Jeff John Roberts  · 15 Dec 2020  · 226pp  · 65,516 words

The World Without Us

by Alan Weisman  · 5 Aug 2008  · 482pp  · 106,041 words

The Singularity Is Near: When Humans Transcend Biology

by Ray Kurzweil  · 14 Jul 2005  · 761pp  · 231,902 words

Our Dollar, Your Problem: An Insider’s View of Seven Turbulent Decades of Global Finance, and the Road Ahead

by Kenneth Rogoff  · 27 Feb 2025  · 330pp  · 127,791 words

City Limits: Infrastructure, Inequality, and the Future of America's Highways

by Megan Kimble  · 2 Apr 2024  · 430pp  · 117,211 words

Mutiny: The Rise and Revolt of the College-Educated Working Class

by Noam Scheiber  · 6 Apr 2026  · 399pp  · 120,332 words

Scarcity Brain: Fix Your Craving Mindset and Rewire Your Habits to Thrive With Enough

by Michael Easter  · 25 Sep 2023  · 318pp  · 95,383 words

We Are as Gods: A Survival Guide for the Age of Abundance

by Peter H. Diamandis and Steven Kotler  · 13 Apr 2026  · 225pp  · 76,418 words

Global Catastrophic Risks

by Nick Bostrom and Milan M. Cirkovic  · 2 Jul 2008

America in the World: A History of U.S. Diplomacy and Foreign Policy

by Robert B. Zoellick  · 3 Aug 2020

Underwater: How Our American Dream of Homeownership Became a Nightmare

by Ryan Dezember  · 13 Jul 2020  · 279pp  · 87,875 words

Kleptopia: How Dirty Money Is Conquering the World

by Tom Burgis  · 7 Sep 2020  · 476pp  · 139,761 words

Zero to Sold: How to Start, Run, and Sell a Bootstrapped Business

by Arvid Kahl  · 24 Jun 2020  · 461pp  · 106,027 words

Devil Take the Hindmost: A History of Financial Speculation

by Edward Chancellor  · 31 May 2000  · 860pp  · 227,491 words

Supertall: How the World's Tallest Buildings Are Reshaping Our Cities and Our Lives

by Stefan Al  · 11 Apr 2022  · 300pp  · 81,293 words

The Internet Is Not What You Think It Is: A History, a Philosophy, a Warning

by Justin E. H. Smith  · 22 Mar 2022  · 198pp  · 59,351 words

The Psychology of Money: Timeless Lessons on Wealth, Greed, and Happiness

by Morgan Housel  · 7 Sep 2020  · 209pp  · 53,175 words

Drunk: How We Sipped, Danced, and Stumbled Our Way to Civilization

by Edward Slingerland  · 31 May 2021

Butler to the World: How Britain Became the Servant of Tycoons, Tax Dodgers, Kleptocrats and Criminals

by Oliver Bullough  · 10 Mar 2022  · 257pp  · 80,698 words

Wanderers: A Novel

by Chuck Wendig  · 1 Jul 2019  · 1,028pp  · 267,392 words

Women Talk Money: Breaking the Taboo

by Rebecca Walker  · 15 Mar 2022  · 322pp  · 106,663 words

Too Much and Never Enough: How My Family Created the World's Most Dangerous Man

by Mary L. Trump  · 13 Jul 2020  · 269pp  · 72,752 words

The Aristocracy of Talent: How Meritocracy Made the Modern World

by Adrian Wooldridge  · 2 Jun 2021  · 693pp  · 169,849 words

King Richard: Nixon and Watergate--An American Tragedy

by Michael Dobbs  · 24 May 2021  · 426pp  · 117,722 words

The Pattern Seekers: How Autism Drives Human Invention

by Simon Baron-Cohen  · 14 Aug 2020

Lonely Planet Belgium & Luxembourg

by Lonely Planet

Fodor's Essential Belgium

by Fodor's Travel Guides  · 23 Aug 2022

Growth: From Microorganisms to Megacities

by Vaclav Smil  · 23 Sep 2019

Data Action: Using Data for Public Good

by Sarah Williams  · 14 Sep 2020

Horizons: The Global Origins of Modern Science

by James Poskett  · 22 Mar 2022  · 564pp  · 168,696 words

The Knowledge Machine: How Irrationality Created Modern Science

by Michael Strevens  · 12 Oct 2020

Generations: The Real Differences Between Gen Z, Millennials, Gen X, Boomers, and Silents—and What They Mean for America's Future

by Jean M. Twenge  · 25 Apr 2023  · 541pp  · 173,676 words

Billion Dollar Loser: The Epic Rise and Spectacular Fall of Adam Neumann and WeWork

by Reeves Wiedeman  · 19 Oct 2020  · 303pp  · 100,516 words

Eurowhiteness: Culture, Empire and Race in the European Project

by Hans Kundnani  · 16 Aug 2023  · 198pp  · 54,815 words

Invention: A Life

by James Dyson  · 6 Sep 2021  · 312pp  · 108,194 words

Built on a Lie: The Rise and Fall of Neil Woodford and the Fate of Middle England’s Money

by Owen Walker  · 4 Mar 2021  · 278pp  · 82,771 words

The Breakup Monologues: The Unexpected Joy of Heartbreak

by Rosie Wilby  · 26 May 2021  · 227pp  · 67,264 words

Secrets of the Autistic Millionaire: Everything I Know Now About Autism and Asperger's That I Wish I'd Known Then

by David William Plummer  · 14 Sep 2021

Drama Queen: One Autistic Woman and a Life of Unhelpful Labels

by Sara Gibbs  · 23 Jun 2021  · 263pp  · 89,341 words

Mini Farming: Self-Sufficiency on 1/4 Acre

by Brett L. Markham  · 14 Apr 2010  · 252pp  · 73,387 words

The Bond King: How One Man Made a Market, Built an Empire, and Lost It All

by Mary Childs  · 15 Mar 2022  · 367pp  · 110,161 words

Money: The True Story of a Made-Up Thing

by Jacob Goldstein  · 14 Aug 2020  · 199pp  · 64,272 words

We Are Bellingcat: Global Crime, Online Sleuths, and the Bold Future of News

by Eliot Higgins  · 2 Mar 2021  · 277pp  · 70,506 words

Things That Matter: Overcoming Distraction to Pursue a More Meaningful Life

by Joshua Becker  · 19 Apr 2022  · 215pp  · 62,479 words

Working Identity, Updated Edition, With a New Preface: Unconventional Strategies for Reinventing Your Career

by Herminia Ibarra  · 17 Oct 2023  · 200pp  · 67,943 words

Heavy Metal: The Hard Days and Nights of the Shipyard Workers Who Build America's Supercarriers

by Michael Fabey  · 13 Jun 2022  · 319pp  · 102,839 words

Slouching Towards Utopia: An Economic History of the Twentieth Century

by J. Bradford Delong  · 6 Apr 2020  · 593pp  · 183,240 words

Internet for the People: The Fight for Our Digital Future

by Ben Tarnoff  · 13 Jun 2022  · 234pp  · 67,589 words

Underestimated: An Autism Miracle

by J. B. Handley and Jamison Handley  · 23 Mar 2021  · 130pp  · 42,093 words

It's Not TV: The Spectacular Rise, Revolution, and Future of HBO

by Felix Gillette and John Koblin  · 1 Nov 2022  · 575pp  · 140,384 words

Inheritance

by Leo Hollis  · 334pp  · 103,106 words

Nomad Century: How Climate Migration Will Reshape Our World

by Gaia Vince  · 22 Aug 2022  · 302pp  · 92,206 words

Re-Educated: Why It’s Never Too Late to Change Your Life

by Lucy Kellaway  · 30 Jun 2021  · 184pp  · 60,229 words

Pandora's Box: How Guts, Guile, and Greed Upended TV

by Peter Biskind  · 6 Nov 2023  · 543pp  · 143,084 words

Ask Your Developer: How to Harness the Power of Software Developers and Win in the 21st Century

by Jeff Lawson  · 12 Jan 2021  · 282pp  · 85,658 words

The Antisocial Network: The GameStop Short Squeeze and the Ragtag Group of Amateur Traders That Brought Wall Street to Its Knees

by Ben Mezrich  · 6 Sep 2021  · 239pp  · 74,845 words

Attention Factory: The Story of TikTok and China's ByteDance

by Matthew Brennan  · 9 Oct 2020  · 282pp  · 63,385 words

The Man Who Broke Capitalism: How Jack Welch Gutted the Heartland and Crushed the Soul of Corporate America—and How to Undo His Legacy

by David Gelles  · 30 May 2022  · 318pp  · 91,957 words

Money in the Metaverse: Digital Assets, Online Identities, Spatial Computing and Why Virtual Worlds Mean Real Business

by David G. W. Birch and Victoria Richardson  · 28 Apr 2024  · 249pp  · 74,201 words

The Last Ride of the Pony Express: My 2,000-Mile Horseback Journey Into the Old West

by Will Grant  · 14 Oct 2023  · 246pp  · 82,965 words

Blood in the Machine: The Origins of the Rebellion Against Big Tech

by Brian Merchant  · 25 Sep 2023  · 524pp  · 154,652 words

Palo Alto: A History of California, Capitalism, and the World

by Malcolm Harris  · 14 Feb 2023  · 864pp  · 272,918 words

Last Best Hope: America in Crisis and Renewal

by George Packer  · 14 Jun 2021  · 173pp  · 55,328 words

The Rough Guide to Switzerland (Travel Guide eBook)

by Rough Guides  · 24 May 2022

Secrets of the Sprakkar

by Eliza Reid  · 15 Jul 2021

The Passenger

by AA.VV.  · 23 May 2022  · 192pp  · 59,615 words

Open Space: From Earth to Eternity--the Global Race to Explore and Conquer the Cosmos

by David Ariosto  · 24 Mar 2026  · 433pp  · 116,344 words

Morning After the Revolution: Dispatches From the Wrong Side of History

by Nellie Bowles  · 13 May 2024  · 207pp  · 62,397 words

Practical Anarchism: A Guide for Daily Life

by Scott. Branson  · 14 Jun 2022  · 198pp  · 63,612 words

How to Blow Up a Pipeline

by Andreas Malm  · 4 Jan 2021  · 156pp  · 49,653 words

The Price of Time: The Real Story of Interest

by Edward Chancellor  · 15 Aug 2022  · 829pp  · 187,394 words

Korea--Culture Smart!

by Culture Smart!  · 15 Jun 201  · 124pp  · 37,476 words

Being You: A New Science of Consciousness

by Anil Seth  · 29 Aug 2021  · 418pp  · 102,597 words

Same as Ever: A Guide to What Never Changes

by Morgan Housel  · 7 Nov 2023  · 210pp  · 53,743 words

Why Machines Learn: The Elegant Math Behind Modern AI

by Anil Ananthaswamy  · 15 Jul 2024  · 416pp  · 118,522 words

I Deliver Parcels in Beijing

by Hu Anyan  · 240pp  · 83,473 words

Win Every Argument: The Art of Debating, Persuading, and Public Speaking

by Mehdi Hasan  · 27 Feb 2023  · 307pp  · 93,073 words

Rough Sleepers: Dr. Jim O'Connell's Urgent Mission to Bring Healing to Homeless People

by Tracy Kidder  · 17 Jan 2023  · 270pp  · 88,213 words

Experience Wales 2

by Lonely Planet

Material World: A Substantial Story of Our Past and Future

by Ed Conway  · 15 Jun 2023  · 515pp  · 152,128 words

The Rough Guide to Wales

by Rough Guides  · 14 Oct 2024  · 882pp  · 240,215 words

There's Got to Be a Better Way

by Nelson P. Repenning and Donald C. Kieffer  · 26 Aug 2025  · 258pp  · 85,605 words

Our Moon: How Earth's Celestial Companion Transformed the Planet, Guided Evolution, and Made Us Who We Are

by Rebecca Boyle  · 16 Jan 2024  · 354pp  · 109,574 words

Shielded: How the Police Became Untouchable

by Joanna Schwartz  · 14 Feb 2023  · 422pp  · 114,817 words

Billionaires' Row: Tycoons, High Rollers, and the Epic Race to Build the World's Most Exclusive Skyscrapers

by Katherine Clarke  · 13 Jun 2023  · 454pp  · 127,319 words

Who Owns This Sentence?: A History of Copyrights and Wrongs

by David Bellos and Alexandre Montagu  · 23 Jan 2024  · 305pp  · 101,093 words

Escape From Model Land: How Mathematical Models Can Lead Us Astray and What We Can Do About It

by Erica Thompson  · 6 Dec 2022  · 250pp  · 79,360 words

The Rough Guide to Australia (Travel Guide eBook)

by Rough Guides  · 14 Oct 2023  · 1,955pp  · 521,661 words

House of Huawei: The Secret History of China's Most Powerful Company

by Eva Dou  · 14 Jan 2025  · 394pp  · 110,159 words

New York City Like a Local

by Dk Eyewitness  · 168pp  · 33,675 words

After Nations: The Making and Unmaking of a World Order

by Rana Dasgupta  · 27 Apr 2026  · 686pp  · 188,424 words

Austin Like a Local

by DK  · 171pp  · 34,369 words

Barcelona Like a Local: by the People Who Call It Home

by Dk Eyewitness

The Library: A Fragile History

by Arthur Der Weduwen and Andrew Pettegree  · 14 Oct 2021  · 457pp  · 173,326 words

The Soul of Wealth

by Daniel Crosby  · 19 Sep 2024  · 229pp  · 73,085 words

The Quiet Coup: Neoliberalism and the Looting of America

by Mehrsa Baradaran  · 7 May 2024  · 470pp  · 158,007 words