by Nicholas A. Christakis · 27 Oct 2020 · 475pp · 127,389 words
was unfolding. Along with a broad range of scientists, including epidemiologists, virologists, physicians, sociologists, and economists, I turned to Twitter to post tutorial threads on coronavirus-related topics such as the mortality rate in children and the elderly, the reasons we had to “flatten the curve,” the nature of immunity after
…
information, shut down the lab that had done this important work for “rectification.”60 SARS-2 is in the family of viruses knowns as coronaviruses. Some species of coronaviruses cause the common cold in humans; others afflict some of our domesticated animals, like pigs, cats, and chickens. Genetic sequencing showed that
…
due to the cessation of manufacturing activity.87 * * * The emergence of pandemics is not restricted to the twentieth century or to respiratory illnesses caused by coronavirus or influenza, of course. Dramatic outbreaks of infectious diseases have afflicted human beings for a long time. Pathogens are just as important to our species
…
For instance, another survey conducted at the end of April 2020 reported that 67 percent of Americans were “somewhat concerned” or “very concerned” about getting coronavirus themselves. But Americans were even more concerned that their family members would get the virus, with 79 percent expressing this fear.12 Another more clinically
…
time, in another survey conducted after mitigation efforts to flatten the disease curve were well under way, Americans became slightly less fearful of contracting the coronavirus (57 percent were worried in April compared to 51 percent in May), but they became slightly more concerned about severe financial hardship (48 percent
…
of Americans rated as “very important” the following conditions for resuming normal everyday activities at that time: (1) mandatory quarantine for anyone testing positive for coronavirus, (2) improved medical therapies to prevent or treat COVID-19, and (3) significant reduction in the number of new cases or deaths.16 * * * In
…
targeted young and healthy people would be better. But most persuasively, detailed genetic analyses of the pathogen show a pattern of descent from prior bat coronaviruses and of randomly occurring genetic mutations that are not compatible with deliberate genetic engineering.72 However, it is very difficult to totally exclude the possibility
…
organization in Florida calling itself the Genesis II Church of Health and Healing was ordered by a judge to stop selling its “sacramental dosing for coronavirus,” which consisted of a powerful bleaching agent ordinarily used as an industrial chemical.76 The organization described its purported elixir as a “miracle mineral
…
of structural power in the network, dominating the conversation and increasingly winning out against true information.101 * * * The circulation of truth and lies during the coronavirus pandemic was also heightened inadvertently by the increasing use by scientists of a new tool for communication, known as preprint servers, that in some ways
…
carefully vetted (even robust studies are improved significantly by undergoing peer review), and nonexperts usually lack the skills to evaluate its scientific validity. During the coronavirus pandemic, therefore, preprint servers contributed to dissemination of true information but also to what the WHO called an “infodemic” of false information. Online platforms
…
of this pathogen was bad enough without exaggeration of preliminary information making things worse. Another glaring example was an erroneous preprint that claimed that the coronavirus—impossibly—had insertions of genetic material from HIV. By the time scientists had debunked this study, prompting its wholesale withdrawal, it had entered into
…
and those considered blameworthy. Simpleminded Manichaean thinking surges—good versus evil, us versus them. Let’s look at some existing divisions in our society that coronavirus highlights—such as age, sex, race, and socioeconomic status—and then at some new ones it will likely foster. * * * One of the unusual features
…
combinations of gene variants. This variety could result in an immunity advantage compared to the more fixed expression in males.51 * * * Like other infectious diseases, coronavirus strikes differentially along socioeconomic lines. While this pandemic did not cause the structural inequalities in our society, it nevertheless brought them into stark relief. We
…
in the surrounding communities. The pathogen, having brewed at the factories, spread outward.65 * * * Ethnic and racial disparities in the attack rate and CFR of coronavirus also became clear not long after the pandemic struck the United States. The findings typified the usual patterns of differential burden of infectious diseases seen
…
virus vaccines are among the most effective methods of vaccination known, usually conferring very good and long-term immunity. Moderately successful veterinary vaccines for various coronavirus species (used in pigs, cows, cats, and so on) have been of the live attenuated variety, which raises hope for similar success in humans
…
part of their contribution, some scientists attempted to create genetically engineered animals that expressed the human form of the ACE2 protein (the one that the coronavirus latches onto), which would allow still other scientists to more rapidly assess the efficacy of the vaccines they were developing. A whole independent set
…
the opportunity to use our capacities for teaching and learning in order to enhance our survival. * * * One classic study of immunity and symptoms related to coronavirus (involving the 229E strain, which causes the common cold), published in 1990, involved an odd twist.85 Fifteen volunteers were deliberately infected with the virus
…
hope for our modern metropolises. Some of the most densely populated places on earth—Asian cities—have, to date, been very successful in containing the coronavirus pandemic. As we saw before, this paradox illustrates another important feature of our evolutionary heritage: the human capacity for cultural innovation and learning. Modern living
…
).29 Central nervous system symptoms were also more pronounced in that pandemic than is typical of influenza, according to historical accounts, and the OC43 coronavirus is known to be neuro-invasive.30 Another suggestive piece of evidence comes from work that indicates that the Russian flu showed a disproportionate increase
…
shape mortality function, which is unusual for influenza (remember that influenza usually manifests a more pronounced U-shaped function).31 OC43 and a particular bovine coronavirus species show remarkable similarities in their genetic sequences and in the chemical structures of the proteins that elicit an immune response. And by comparison with
…
to an Infectious Disease Hospital, Residents near the Huanan Market Found Infected,” Beijing News, January 2, 2020. 13 Anonymous, “China Detects Large Quantity of Novel Coronavirus at Wuhan Seafood Market,” XinhuaNet, January 27, 2020. 14 J.Q. Gong, “The Whistle-Giver,” People Magazine (China), March 10, 2020. 15 J.X.
…
Provincial People’s Congress Will Be Held on January 12th, 2020,” People’s Daily Online, November 29, 2019; P. Zhuang, “Chinese Laboratory That First Shared Coronavirus Genome with World Ordered Closed for ‘Rectification,’ Hindering Its COVID-19 Research,” South China Morning Post, February 28, 2020. 17 T. Reals, “Chinese Doctor Was
…
of Whistle-Blowing Doctor Li Wenliang,” South China Morning Post, March 19, 2020. 19 C. Buckley, “Chinese Doctor, Silenced After Warning of Outbreak, Dies from Coronavirus,” New York Times, February 6, 2020; Anonymous, “China Identifies 14 Hubei Frontline Workers, Including Li Wenliang, as Martyrs,” Global Times, April 2, 2020. 20
…
. 8 Anonymous, “Hospital Beds (per 1,000 People),” World Bank Data, 2015. 9 L. Frias, “Thousands of Chinese Doctors Volunteered for the Frontline of the Coronavirus Outbreak. They Are Overwhelmed, Under-Equipped, Exhausted, and Even Dying,” Business Insider, February 7, 2020. 10 M. Van Beusekom, “Doctors: COVID-19 Pushing Italian
…
the White House,” Washington Post, April 10, 2020. 63 E. Christakis, The Importance of Being Little, New York: Viking, 2015, p. 136. 64 Anonymous, “Map: Coronavirus and School Closures,” Education Week, March 6, 2020. 65 National Center for Education Statistics, “Digest of Education Statistics: Table 105.20. Enrollment in Elementary, Secondary
…
and Secondary Schools,” U.S. Department of Education Institute of Education Sciences, March 2019. 66 J. Couzin-Frankel, “Does Closing Schools Slow the Spread of Coronavirus? Past Outbreaks Provide Clues,” Science, March 10, 2020. 67 W. Van Lancker and Z. Parolin, “COVID-19, School Closures, and Child Poverty: A Social
…
Measures for Response to an Influenza Pandemic,” Paediatric Respiratory Reviews 2015; 16: 119–126; R.M. Viner et al., “School Closure and Management Practices during Coronavirus Outbreaks Including COVID-19: A Rapid Systematic Review,” Lancet Child & Adolescent Health 2020; 4: 397–404. 69 S. Hsiang, et al., “The Effect of
…
Influenza Pandemic in US Cities,” Proceedings of the National Academy of Sciences 2007; 104: 7588–7593. 74 Anonymous, “School Closures Begin as Japan Steps Up Coronavirus Fight,” Kyodo News, May 2, 2020. 75 S. Kawano and M. Kakehashi, “Substantial Impact of School Closure on the Transmission Dynamics during the Pandemic
…
-Up Service,” Los Angeles Times, April 8, 2020. 2 C. Engelbrecht and C. Kim, “Zoom Shivas and Prayer Hotlines: Ultra-Orthodox Jewish Traditions Upended by Coronavirus,” New York Times, April 16, 2020. 3 N.A. Christakis, Death Foretold: Prophecy and Prognosis in Medical Care, Chicago: University of Chicago Press, 1999;
…
S. Taylor, The Psychology of Pandemics, Newcastle upon Tyne: Cambridge Scholars Publications, 2020. 20 K. King, “Daily Cheers Give Morale Boost to Medical Workers Fighting Coronavirus,” Wall Street Journal, April 18, 2020; A. Mohdin, “Pots, Pans, Passion: Britons Clap Their Support for NHS Workers Again,” The Guardian, April 2, 2020.
…
63 D. Diamond, “Suddenly, Public Health Officials Say Social Justice Matters More Than Social Distance,” Politico, June 4, 2020. 64 M. Bebinger et al., “New Coronavirus Hot Spots Emerge across South and in California, As Northeast Slows,” NPR, June 5, 2020. 65S. Pei et al., “Differential Effects of Intervention Timing on
…
Quaresima, “Warning Letter,” United States Food and Drug Administration, March 6, 2020. 83 K. Rogers, “Trump’s Suggestion That Disinfectants Could Be Used to Treat Coronavirus Prompts Aggressive Pushback,” New York Times, April 24, 2020. 84 L. Wade, “The Secret Life of Vintage Lysol Douche Ads,” Society Pages, September 27, 2013
…
.J. Mercuro et al., “Risk of QT Interval Prolongation Associated with Use of Hydroxychloroquine with or without Concomitant Azithromycin among Hospitalized Patients Testing Positive for Coronavirus Disease 2019 (COVID-19),” JAMA Cardiology, May 1, 2020; J. Yazdany and A.H.J. Kim, “Use of Hydroxychloroquine and Chloroquine during the COVID-
…
Callousness toward AIDS Victims,” New York Times, November 7, 1987. 11 R. Brackett, “Governor Says State Will Accept Florida Residents from Cruise Ship Stricken with Coronavirus,” Weather Channel, April 1, 2020; M. Burke, K. Sanders, “Cruise Ship with Sick Passengers and Sister Ship Dock in Florida,” NBC News, April 3,
…
2020. 12 D. Quan, “‘Dreams Are Not Passports’: Remote Arctic Village Residents Recount Bizarre Encounter with Quebec Couple Fleeing Coronavirus,” The Star [Toronto], March 30, 2020. 13 Procopius, History of the Wars, trans. H.B. Dewing, Cambridge, MA: Harvard University Press, 1914, p. 453.
…
Patients, Later Rescinds Them,” Journal of Emergency Medical Services, April 22, 2020. 46 C. Huang et al., “Clinical Features of Patients Infected with 2019 Novel Coronavirus in Wuhan, China,” The Lancet 2020; 395: 497–506. 47 C.M. Petrilli et al., “Factors Associated with Hospital Admission and Critical Illness among
…
Hormones Regulate Innate Immune Cells and Promote Sex Differences in Respiratory Virus Infection,” Frontiers in Immunology 2018; 9: 1653. 50 P. Conti and A. Younes, “Coronavirus COV-19/SARS-CoV-2 Affects Women Less Than Men: Clinical Response to Viral Infection,” Journal of Biological Regulators and Homeostatic Agents 2020; 34: 32253888
…
on Time to Clinical Improvement in Patients with Severe and Life-Threatening COVID-19: A omized Clinical Trial,” JAMA, June 3, 2020. 63 D. Lowe, “Coronavirus Vaccine Prospects,” Science Translational Medicine, April 15, 2020. 64 D.R. Hopkins, The Greatest Killer: Smallpox in History, with a New Introduction, Chicago: University
…
of Chicago Press, 2002, p. 80. 65 L.J. Saif, “Animal Coronavirus Vaccines: Lessons for SARS,” Developments in Biologicals 2004; 119: 129–140. 66 H. Wang et al., “Development of an Inactivated Vaccine Candidate, BBIBP-CorV, with
…
al., “Development of an Inactivated Vaccine Candidate for SARS-CoV-2,” Science 2020; 369: 77–81; J. Cohen, “Covid-19 Vaccine Protects Monkeys from New Coronavirus, Chinese Biotech Reports,” Science, April 23, 2020. 68 F.C. Zhu et al., “Safety, Tolerability, and Immunogenicity of a Recombinant Adenovirus Type-5 Vectored
…
) for Phase 1 Study,” Moderna, February 24, 2020. 70 Anonymous, “Moderna Announces Positive Interim Phase 1 Data for Its mRNA Vaccine (mRNA-1273) against Novel Coronavirus,” Moderna, May 18, 2020. 71 Anonymous, “Moderna Reports Positive Data from Phase I COVID-19 Vaccine Trial,” Moderna, May 19, 2020. 72 G. Ramon,
…
Development Landscape,” Nature Reviews Drug Discovery 2020; 19: 305–306. 77 K.A. Callow et al., “The Time Course of the Immune Response to Experimental Coronavirus Infection of Man,” Epidemiology and Infection 1990; 105: 435–446; L.P. Wu et al., “Duration of Antibody Responses after Severe Acute Respiratory Syndrome,”
…
a Pandemic: Social Networks and the Macroeconomic Response of Consumption,” SSRN, May 17, 2020. 61 Associated Press, “U.S. Online Alcohol Sales Jump 243% during Coronavirus Pandemic,” MarketWatch, April 2, 2020. 62 W. Oremus, “What Everyone’s Getting Wrong about the Toilet Paper Shortage,” Medium Marker, April 2, 2020. 63
…
. Joseph, “Roll Call: The Importance of Teacher Attendance,” National Council on Teacher Quality, June 2014. 86 G. Viglione, “How Scientific Conferences Will Survive the Coronavirus Shock,” Nature, June 2, 2020. 87 L.B. Kahn, “The Long-Term Labor Market Consequences of Graduating from College in a Bad Economy,” Labour Economics
…
Protocol: Prospective Observational Cohort Study,” British Medical Journal 2020; 369: m1985; Y. Wu et al., “Nervous System Involvement after Infection with COVID-19 and Other Coronaviruses,” Brain, Behavior, and Immunity 2020; 87: 18–22; S.H. Wong et al., “COVID-19 and the Digestive System,” Journal of Gastroenterology and Hepatology
by Jonathan Calvert and George Arbuthnott · 18 Mar 2021 · 432pp · 143,491 words
4, Ireland First published by HarperCollinsPublishers 2021 FIRST EDITION © Jonathan Calvert and George Arbuthnott 2021 Cover design Steve Leard © HarperCollinsPublishers 2021 Sunday Times graphics on coronavirus © The Sunday Times/News Licensing While every effort has been made to trace the owners of copyright material reproduced herein and secure permissions, the publishers
…
-19 world. As investigative reporters for The Sunday Times, we produced a series of articles throughout 2020 examining the UK government’s reaction to the coronavirus crisis and attempting to understand how this country – which prided itself on its pandemic defences – managed to get it so badly wrong. Our first
…
decision – for thousands of people. A study by Imperial College London’s pandemic modellers and Oxford University’s department of statistics has estimated that coronavirus infections across the UK rocketed from an estimated 200,000 to 1.5 million in the nine days before lockdown as the prime minister agonised
…
corona) when viewed under a microscope because of the spikes protruding from their surface. Before Covid-19 appeared in 2019 there were six types of coronavirus known to infect humans, but mostly they caused mild respiratory symptoms with the exception of the Middle East Respiratory Syndrome in 2012 and Sars, which
…
who had spearheaded his country’s efforts to combat the Sars pandemic nine years earlier. Aware the men might be suffering from another Sars-related coronavirus, he advised they be tested for antibodies against Sars, which would have shown whether the men had previously contracted the virus. These tests were
…
more infectious to humans. Papers released by the Wuhan Institute of Virology between 2015 and 2017 describe how Shi’s team combined snippets of different coronaviruses to see if they could be made more transmissible to humans. They called them ‘virus infectivity experiments’. This type of ‘gain-of-function’ work
…
virus] emerged that we found that it was close to Sars-2.’ Other scientists find this indifference to a new strain of a potentially deadly coronavirus hard to believe. Nikolai Petrovsky, Professor of Medicine at Flinders University in Adelaide, South Australia, and secretary-general of the International Immunomics Society, has
…
outcome of the tests inside the market was released later that month, the Chinese state news agency Xinhua reported: ‘The results suggest that the novel coronavirus outbreak is highly relevant to the trading of wild animals.’ However, the picture was far more complicated than it first seemed. An early study
…
spreading rapidly. But in those early days of January, the Chinese scientists did not seek help from international colleagues because the existence of the new coronavirus remained a strict secret. Using a technique to amplify the virus’s genetic material, her team swiftly managed to confirm that samples from five
…
patients at the Wuhan Jinyintan Hospital had genetic sequences present in all coronaviruses. These were sent to a team led by Professor Zhang Yongzhen of the Shanghai Public Health Clinical Centre laboratory, which was able to map
…
has greatly affected the scientists and their research when they should be racing against the clock to find the means to help put the novel coronavirus outbreak under control,’ the source said. The Shanghai Health Commission refused to say what lay behind the decision. Hours after Zhang’s team released
…
, a small band of scientists, academics and enthusiasts from different countries were messaging each other, questioning whether RaTG13 might actually have been the novel coronavirus that Shi had described in her 2016 paper chronicling the results of her team’s sampling in the mine. Despite repeated requests Shi and the
…
of the crisis later unravelled, the public would become increasingly concerned about the committee’s lack of transparency. More information was emerging about the new coronavirus on the day of the first Sage meeting. Chinese scientists were warning that the virus had an unusually high infectivity rate – known as the
…
were allowed to travel across Britain at will. The researchers estimated that up to 1,900 of these passengers would have been infected with the coronavirus – guaranteeing the UK would become a centre of the subsequent pandemic. Sure enough, five days after the Cobra meeting, on Wednesday 29 January, the
…
health secretary having gone on record saying that whistle-blowers in the National Health Service should be protected. Only after the story broke – as the coronavirus was beginning to spread across the world – did Hancock relent to the growing pressure and order an inquiry in early 2020. It raised questions
…
a contract agreeing to accept a 14-day quarantine, which would be spent in hospital accommodation on Merseyside. The following day the WHO declared the coronavirus threat to be a global public health emergency because of the spread of the virus outside of China. It was an ‘unprecedented outbreak’, according
…
the newspaper’s glass London Bridge headquarters and articulated for the first time the shift we were beginning to witness in the media’s attention. ‘Coronavirus is the new Brexit,’ he said. He was correct. The story was only getting bigger and bigger as its catastrophic and devastating ramifications became
…
complacency at the heart of government. Answering questions from MPs, Hancock repeated his message that the NHS had the capacity to treat 50 to 500 coronavirus patients. He was asked by a friendly Conservative colleague, Dr Caroline Johnson MP, whether there were preparations for a wider package of measures – such
…
has since decided to pause implementation of the proposed mobile alerting system,’ it states. The last rehearsal for a pandemic before the emergence of the coronavirus hardly inspired confidence. Run by Public Health England in October 2016, the three-day operation codenamed Cygnus tested how more than 950 officials – including
…
plan had been mothballed around the time the Brexit planning got very intense in 2017.’ It meant that in the years leading up to the coronavirus outbreak, key government committee meetings on pandemic planning were repeatedly ‘bumped’ off the diary to make way for discussions about what were deemed more
…
national pandemic stockpile had been established in 2009 following the swine flu outbreak, with around £500m being spent on protective equipment. By the time the coronavirus pandemic began, the stockpile was mostly housed in a 370,000-square-foot distribution centre in Merseyside that had been built specifically for the purpose
…
’. It concluded ministers had plenty of time and ample warning but had done next to nothing. It said: ‘Despite the first reported case of coronavirus being confirmed by the chief medical officer in England on 31 January 2020, the Treasury did not announce plans for significant funding to support businesses
…
to anticipate looming problems before it was too late’ and expressed his concerns about ‘curtailed cabinet meetings’ where issues such as the economic impact of coronavirus received just five minutes of ‘discussion in January’. It had often been noted by those who worked with Johnson that he had a habit of
…
Tedros Adhanom Ghebreyesus, the World Health Organization director-general, issued a stark warning. He said the opportunity to contain the wider spread of the deadly coronavirus was slipping away. ‘The window of opportunity is narrowing, so we need to act quickly before it closes completely,’ he declared. 6 Part-Time Prime
…
was initially prevalent among younger people in the country’s ski resorts, who were either: asymptomatic; mildly affected; or their illness wasn’t recognised as coronavirus. On the day before the Conservatives’ ball, Italy had been forced to bring in the first control measures, with the country’s sports minister
…
each strain had originated by comparing it to samples taken in other countries. They found that more than 1,000 different people had brought the coronavirus into Britain, which ruled out the idea that one superspreader or ‘patient zero’ sparked the outbreak. Most of the infections in February had indeed
…
a surge in patients needing ventilation to help them breathe. They warned that weaker patients could therefore be denied life-saving care during a severe coronavirus outbreak, with senior consultants being left in the invidious position of having to decide who would be given access to ventilators and beds. Professor
…
an interest in the crisis that was gripping his nation. That morning he summoned Hancock and Whitty into Downing Street to specifically discuss concerns about coronavirus. Eight weeks after reports of the new virus had emerged and after missing all five Cobra meetings on the subject, the prime minister had
…
Monday. In a letter to the European Society of Intensive Care Medicine, they revealed that up to 10 per cent of all those infected with coronavirus in Italy had needed intensive care. This, according to the three authors of the letter – professors Maurizio Cecconi, Antonio Pesenti and Giacomo Grasselli from
…
would not be overwhelmed, as they were in Italy. That day the London Ambulance Service increased the threshold for the severity of symptoms that a coronavirus patient would have to typically exhibit before they would be taken to hospital. This had dangerous consequences. The sense of impatience with the government’
…
that week before lockdown, the health service’s burden was increasing by a third. The complacency that had allowed Johnson to sail through February believing coronavirus to be a medically ‘irrational panic’ was rapidly dissipating. His government was panicking and nothing showed this more clearly than the chancellor Rishi Sunak’s
…
a bad example. And they were also endangering lives. In times of extremis, extraordinary things happen with hardly anyone batting an eyelid. That day the Coronavirus Act – the most authoritarian new law since the Second World War, which set out the legal basis for lockdown – raced through parliament with little
…
were forced to deploy the tool or a version of it. They had been faced with an impossible situation with far too many severely ill coronavirus patients requiring intensive care when there were insufficient beds or staff available. The government-commissioned age-based ‘triage tool’ was the only guidance they
…
place in hospital had been displaced to people’s homes and the care homes. This huge increase in deaths outside hospitals was a mixture of coronavirus cases – many of which were never diagnosed – and people who were not given treatment for other conditions that they would normally have received had
…
were dispatched from hospitals into care homes that were completely open to infection and then cross-infection. A third of all care homes declared a coronavirus outbreak, with more than a thousand dealing with positive cases during the peak of infections in April, according to the National Audit Office. Chris
…
least in part, because of his stubborn libertarianism.’ And the criticism went on. Greece’s progressive daily newspaper Ethnos described Johnson as ‘more dangerous than coronavirus’, saying one of the crisis’s greatest tragedies was that ‘incompetent leaders’ such as Johnson and Donald Trump were ‘at the helm at a
…
another outbreak in Westminster and disenfranchising vulnerable MPs. The logistics of observing the two-metre social distancing rule in the Commons while voting created a ‘coronavirus conga’ in which 523 politicians had to form a queue stretching for hundreds of metres. The queue snaked across the courtyards of the Palace
…
room’, while Labour MP Geraint Davies told the Guardian: ‘This is wholly irresponsible publicity by the Conservative government, which will fuel a resurgence of coronavirus infection and death in England.’1 The Treasury quickly backed down and removed the tweet, admitting it had ‘got it wrong’. The NHS high command
…
was ‘creating population immunity’. During the interview, he called on the prime minister to subtly change his language to ‘normalise’ the September rise in coronavirus cases, arguing that it was usual for respiratory-type infections to multiply around that time of year. ‘This is a seasonal effect now, and if
…
Radio 4’s Today programme: ‘The government has consistently throughout this year been ahead of the curve in terms of proactive measures with regards to coronavirus.’ Johnson claimed sarcastically that the criticisms against him amounted to people being wise after the event, when he appeared on BBC One’s Andrew
…
Reuters, 24 May 2011. 4: Sleepwalk 1. ‘Revealed: NHS denied PPE at height of Covid-19 as supplier prioritised China’, Guardian, 20 July 2020. 2. ‘Coronavirus: Did the government get it wrong?’, Dispatches, Channel 4, 3 June 2020. 3. Ibid. 4. ‘Revealed: Value of UK pandemic stockpile fell by 40% in
…
s home’, Guardian, 21 June 2019. 9. ‘Charlotte Edwardes on Boris Johnson’s wandering hands’, The Sunday Times, 29 September 2019. 10. ‘Hospitals prepare for coronavirus epidemic to sweep Britain’, The Sunday Times, 16 February 2020. 11. ‘The prime minister’s vanishing briefs’, The Sunday Times, 23 February 2020. 12. ‘Where
…
February 2020. 7: The Action Plan 1. ‘UK has plans to deal with pandemic causing up to 315,000 deaths’, Guardian, 6 March 2020. 2. ‘Coronavirus: Did the government get it wrong?’, Dispatches, Channel 4, 3 June 2020. 3. Ibid. 8: Herd Immunity 1. ‘Boris Johnson heckled during visit to
…
Covid-19 doing well’, Guardian, 16 April 2020. 3. ‘From evasion to evisceration: How the Cummings lockdown story unfolded’, Guardian, 29 May 2020. 4. ‘Coronavirus: More than 4,000 hospital patients discharged into care homes without test’, Sky News, 17 July 2020. 5. ‘Three nurses forced to wear bin bags
…
22 May 2020. 5. ‘New witnesses cast doubt on Dominic Cummings’s lockdown claims’, Guardian, 23 May 2020. 6. ‘Chief nurse dropped from Downing Street coronavirus briefing “after refusing to back Dominic Cummings”’, Independent, 12 June 2020. 7. ‘Serious weaknesses in the UK’s current plans for suppressing covid-19 risk
…
, 403 Academy of Medical Sciences 237, 336, 338, 353 action plan, UK government (‘contain, delay, research, mitigate’ strategy) 152–66 All-Party Parliamentary Group on Coronavirus 396, 398 ambulance service 95, 190, 224, 237, 243, 247, 264, 265–7, 268, 269, 270, 273, 274–5, 282, 294, 290, 291, 392,
…
203, 401; lockdown and 296, 302, 319, 322, 329, 339, 340, 359 Conte, Giuseppe 192–3 Corbyn, Jeremy 76, 127, 137, 138, 240 Coronavirus Act (2020) 226–7 Coronavirus Clinical Characterisation Consortium 396 Cosford, Paul 64, 109 Costello, Anthony 181, 369 Covid-19 (Sars-CoV-2): asymptomatic spread of 135, 142, 144
by Walter Isaacson · 9 Mar 2021 · 700pp · 160,604 words
the Middle Ages, by repeated viral epidemics. Always prepared and methodical, Doudna (pronounced DOWD-nuh) presented slides that suggested ways they might take on the coronavirus. She led by listening. Although she had become a science celebrity, people felt comfortable engaging with her. She had mastered the art of being tightly
…
acid (RNA) and a similar molecule that lacks one oxygen atom and thus is called deoxyribonucleic acid (DNA). From an evolutionary perspective, both the simplest coronavirus and the most complex human are essentially protein-wrapped packages that contain and seek to replicate the genetic material encoded by their nucleic acids. The
…
the understanding of how little strands of RNA behaved would become increasingly important, both to the field of gene editing and to the fight against coronaviruses. * * * As a young PhD student, Doudna mastered the special combination of skills that distinguished Szostak and other great scientists: she was good at doing
…
a field that would become unexpectedly relevant later in her career: viruses. Specifically, she was interested in how the RNA in some viruses, such as coronaviruses, allow them to hijack the protein-making machinery of cells. During her first semester at Berkeley, in the fall of 2002, there was an
…
. The hope then was that drugs based on RNA interference might someday be a good option for treating severe viral infections, including those from new coronaviruses.7 * * * Doudna’s paper on RNA interference appeared in Science in January 2006. A few months later, a paper published in a little-known
…
pursued an oddity of nature out of pure curiosity, and that seeded the ground for applied technologies such as gene editing and tools to fight coronaviruses. However, as with the transistor, it was not simply a one-way linear progression. Instead, there was an iterative dance among basic scientists, practical
…
her proposal to the foundation. It was a prelude to the funding Doudna would receive from Gates in 2020 to use CRISPR systems to detect coronaviruses.7 CHAPTER 16 Emmanuelle Charpentier The wanderer Conferences can have consequences. While attending one in Puerto Rico in the spring of 2011, Doudna had
…
super-high cholesterol, and male pattern baldness.14 In March of that year, however, most academic research labs were temporarily shut down because of the coronavirus pandemic. An exception was made for labs that were engaged in fighting the virus. Many CRISPR researchers, Doudna foremost among them, would shift their focus
…
commanding MIT biology professor named David Baltimore, who that year would win the Nobel Prize for his work showing that viruses containing RNA, such as coronaviruses, can insert their genetic material into the DNA of a host cell through a process known as “reverse transcription.” In other words, the RNA
…
to fix such traits cross the line from health treatment to enhancement? What about genetic modifications that help prevent a person from getting HIV or coronavirus or cancer or Alzheimer’s? Perhaps for these we need a third category called “preventions” in addition to the ill-defined “treatments” and “enhancements.”
…
is reproductive fitness—what traits might cause an organism to reproduce more—which means it permits, and perhaps even encourages, all sorts of plagues, including coronaviruses and cancers, that afflict an organism once its childbearing use is over. This does not mean that, out of respect for nature, we should quit
…
searching for ways to fight against coronaviruses and cancer.16 * * * There is, however, a more profound argument against playing God, best articulated by the Harvard philosopher Michael Sandel. If we humans
…
us would regard Alzheimer’s or Huntington’s to be a result of giftedness. When we create chemotherapies to fight cancer or vaccines to fight coronaviruses or gene-editing tools to fight birth defects, we are, quite properly, exercising mastery over nature rather than accepting the unbidden as a gift.
…
be used by humans to detect and destroy viruses. More important, she had become a maestro of collaboration. It became clear to her that battling coronavirus would require putting together teams that spanned many specialties. Fortunately, she had a base from which she could build such an effort. She had
…
DNA. The viral sequence provides the code for making a mere twenty-nine proteins.4 Here is a sample snippet of the letters in the coronavirus’s RNA: CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC. That sequence is part of a string that codes for making a protein that sits on the outside of the virus shell
…
have been frozen in a liquid, structural biologists were able to create a precise model, atom by atom and twist by twist, of the coronavirus and its spikes. With the sequencing information and structural data in hand, molecular biologists began racing to find treatments and vaccines that would block the
…
sending out group emails, arranging Zoom meetings, and coordinating equipment.” Berkeley’s legal team came up with a policy for sharing discoveries freely with other coronavirus researchers while protecting the underlying intellectual property. At one of the first meetings, a university lawyer laid out a template for royalty-free licensing. “We
…
Hockemeyer watches CHAPTER 49 Testing America’s failure The first official guidance to local health officials in the U.S. about testing for the new coronavirus came in a conference call on January 15, 2020, led by Stephen Lindstrom, a microbiologist at the Centers for Disease Control (CDC). The CDC
…
Secretary Alex Azar, whose department oversees the FDA, declared a public health emergency. The declaration gave the FDA the right to speed up approvals for coronavirus tests. But it had a weird unintended consequence. In normal circumstances, hospitals and university labs can devise their own tests to use at their facilities
…
volunteer army When Doudna and her colleagues at Berkeley’s Innovative Genomics Institute decided at their March 13 meeting to focus on building their own coronavirus testing lab, there was a discussion about what technology to use. Should it be the cumbersome but reliable process of amplifying the genetic material
…
conference, Doudna watched proudly when Hamilton presented her research on using virus-like particles to deliver CRISPR-Cas9 gene-editing tools into humans. When the coronavirus crisis hit in early March, Hamilton told Doudna that she wanted to get involved like people at her University of Washington alma mater were. So
…
Zhang with Patrick Hsu CHAPTER 51 Mammoth and Sherlock CRISPR as a detection tool At the March 13 meeting that Doudna convened to address the coronavirus, she decided that a top priority was to create a high-speed conventional PCR testing lab. But during the discussion, Fyodor Urnov suggested that
…
they also consider a more innovative idea: using CRISPR to detect the RNA of the coronavirus, similar to how bacteria use CRISPR to detect attacking viruses. “There’s a paper that just came out on that,” a participant interjected. Urnov
…
“Check out the resource provided by Mammoth,” he tweeted, including a link to its white paper. “Glad that scientists are working together and sharing openly. #coronavirus.” That tweet reflected a welcome new trend in the CRISPR world. The passionate competition for patents and prizes had led to secrecy about research and
…
the formation of competing CRISPR companies. But the urgency that Doudna and Zhang and their colleagues felt about defeating the coronavirus pushed them to be more open and willing to share their work. Competition was still an important, and useful, part of the equation. There
…
genetically reengineered a safe virus—an adenovirus that causes flu in chimpanzees—by editing into it the gene to make the spike protein of the coronavirus. Similar vaccines developed by other companies in 2020 used a human version of the adenovirus. The vaccine created by Johnson & Johnson, for example, used
…
why this technique is unpopular, especially with those on the receiving end. * * * One of the teams that Doudna organized at the beginning of the coronavirus crisis in March 2020 focused on these delivery challenges facing DNA vaccines. It was led by her former student Ross Wilson, who now runs his
…
BioNTech launched what they dubbed Project Lightspeed to devise a vaccine based on RNA sequences that would cause human cells to make versions of the coronavirus’s spike protein. Once it looked promising, Şahin called Kathrin Jansen, the head of vaccine research and development at Pfizer. The two companies had
…
blood in September, streaming it live on the internet for everyone to watch, Zayner found evidence that he had developed neutralizing antibodies to fight the coronavirus. He called it a “mild success,” but noted that biology often produces murky results. It gave him a greater appreciation for careful clinical trials.
…
Cameron Myhrvold CHAPTER 54 CRISPR Cures The development of vaccines—both the conventional sort and those employing RNA—would eventually help to beat back the coronavirus pandemic. But they are not a perfect solution. They rely on stimulating a person’s immune system, always a risky thing to do. (Most
…
we could actually deliver on quickly.” In the West Coast orbit of Jennifer Doudna, however, there was a team that was pushing forward with a coronavirus treatment. Similar to the CARVER system that Myhrvold had invented, it would use CRISPR to seek and destroy viruses. Stanley Qi and PAC-MAN
…
. People use these regularly to prepare the lung to be less allergic if they are exposed to something.” The same could be done during a coronavirus pandemic; people could use a nasal spray so that PAC-MAN or another CRISPR-Cas13 prophylactic treatment will protect them. * * * Once the delivery mechanisms
…
, we are a social animal, an instinct that cannot fully be satisfied online. Nevertheless, there will be an upside to the fact that the coronavirus has expanded how we work together and share ideas. By hastening the Age of Zoom, the pandemic will broaden the horizons of scientific collaboration, allowing
…
practical applications. CRISPR and COVID are speeding our entry into a life-science era. Molecules are becoming the new microchips. At the height of the coronavirus crisis, Doudna was asked to write a piece for The Economist on the social transformations being wrought. “Like many other aspects of life these
…
not have coalesced so quickly if they had to worry about intellectual property arrangements. Likewise, scientists around the world contributed to an open database of coronavirus sequences that, by the end of August 2020, had thirty-six thousand entries.4 The sense of urgency about COVID also brushed back the gatekeeper
…
process of building on each new finding and allowed the public to follow the advance of science as it happened. On some important papers involving coronavirus, publication on the reprint servers led to crowdsourced vetting and wisdom from experts around the world.5 George Church says he had long wondered
…
be cross-disciplinary, breaking down academic silos and the walls between labs, which have traditionally been independent fiefdoms that fiercely guard their autonomy. Fighting the coronavirus required collaboration across disciplines. In that way, it resembled the effort to develop CRISPR, which involved microbe-hunters working with geneticists, structural biologists, biochemists,
…
. 3. Author’s interviews with Dave Savage, Gavin Knott, and Jennifer Doudna. 4. Jonathan Corum and Carl Zimmer, “Bad News Wrapped in Protein: Inside the Coronavirus Genome,” New York Times, Apr. 3, 2020; GenBank, National Institutes of Health, SARS-CoV-2 Sequences, updated Apr. 14, 2020. 5. Alexander Walls… David
…
30, 2019; Daniel Chertow, “Next-Generation Diagnostics with CRISPR,” Science, Apr. 27, 2018; Ann Gronowski “Who or What Is SHERLOCK?,” EJIFCC, Nov. 2018. Chapter 52: Coronavirus Tests 1. Author’s interviews with Feng Zhang. 2. Feng Zhang, Omar Abudayyeh, and Jonathan Gootenberg, “A Protocol for Detection of COVID-19 Using CRISPR
…
Diagnostics,” Broad Institute website, posted Feb. 14, 2020; Carl Zimmer, “With Crispr, a Possible Quick Test for the Coronavirus,” New York Times, May 5, 2020. 3. Goldberg, “CRISPR Comes to COVID”; “Sherlock Biosciences and Binx Health Announce Global Partnership to Develop First CRISPR-Based
…
COVID-19 Outbreak,” Biocentury, Feb. 28, 2020. 5. James Broughton… Charles Chiu, Janice Chen, et al., “A Protocol for Rapid Detection of the 2019 Novel Coronavirus SARS-CoV-2 Using CRISPR Diagnostics: SARS-CoV-2 DETECTR,” Mammoth Biosciences website, posted Feb. 15, 2020. The full Mammoth paper with patient data and
…
CoV-2,” Nature Biotechnology, Apr. 16, 2020 (received Mar. 5, 2020). See also Eelke Brandsma… and Emile van den Akker, “Rapid, Sensitive and Specific SARS Coronavirus-2 Detection: A Multi-center Comparison between Standard qRT-PCR and CRISPR Based DETECTR,” medRxiv, July 27, 2020. 6. Julia Joung… Jonathan S. Gootenberg, Omar
…
31, 2020. 14. Sharon LaFraniere, Katie Thomas, Noah Weiland, David Gelles, Sheryl Gay Stolberg and Denise Grady, “Politics, Science and the Remarkable Race for a Coronavirus Vaccine,” New York Times, Nov. 21, 2020; author’s interviews with Noubar Afeyan, Moncef Slaoui, Philip Dormitzer, Christine Heenan. Chapter 54: CRISPR Cures 1. David
…
s Next Virus Killer?,” Wired, Mar. 10, 2020. 16. Timothy Abbott… and Lei [Stanley] Qi, “Development of CRISPR as a Prophylactic Strategy to Combat Novel Coronavirus and Influenza,” bioRxiv, Mar. 14, 2020. 17. Author’s interview with Stanley Qi. 18. IGI weekly Zoom meeting, Mar. 22, 2020; author’s interviews with
…
starter cultures and, xviii, 90–92, 133, 143 CRISPR applications, 243–63 affordability of, 247–48 biohacking, 253–57, 263, 285, 288, 443–44 coronavirus testing, 413, 417 cures for viral infections, 449–57 CARVER, 452–53, 455–57 PAC-MAN, 454–57, 460 defense against terrorists, 259–63 diagnostic
…
, 107–8 fluorescent proteins, 165–67, 382–83 flytrap plants, 171 FokI enzyme, 155 Fonfara, Ines, 137 Food and Drug Administration (FDA), 294, 363, 446 coronavirus tests and, 407–10 Foy, Shaun, 205–7 Frangoul, Haydar, 244 Frankenstein (Shelley), 267, 269, 283, 286, 297 Franklin, Benjamin, 479 Franklin, Rosalind, 21–
…
Jacket montage by Debra Lill Jacket photograph of Jennifer Doudna by Brad Torchia/August Image (The letters are part of the RNA code of the coronavirus that causes COVID.) Library of Congress Cataloging-in-Publication Data Names: Isaacson, Walter, author.Title: The code breaker : Jennifer Doudna, gene editing, and the
by Adam Tooze · 15 Nov 2021 · 561pp · 138,158 words
LC record available at https://lccn.loc.gov/2021016843 LC ebook record available at https://lccn.loc.gov/2021016844 Cover design: Jason Ramirez Cover image: (coronavirus cell) DigitalVision Vectors / Getty Images Book design and graph illustrations by Daniel Lagin, adapted for ebook by Cora Wigen pid_prh_5.7.1_c0
…
was stressing the weakest parts of our personalities and our most intimate relationships. * * * — There have been far more lethal pandemics. What was dramatically new about coronavirus in 2020 was the scale of the response. And that begs a question. As the Financial Times’s chief economic commentator Martin Wolf put it
…
the very unequal consequences of societal risks, whether those be due to structural change in the global division of labor, environmental damage, or disease.43 Coronavirus glaringly exposed our institutional lack of preparation, what Beck called our “organized irresponsibility.” It revealed the weakness of basic apparatuses of state administration, like up
…
was a long-term world historic shift, to which everyone in the world would eventually have to respond. But Beijing’s success in handling the coronavirus and the assertiveness that unleashed were a red flag to the Trump administration. Furthermore, the superheated atmosphere of the American election generated powerful amplification and
…
vision of American government crafted by successive Democratic administrations starting with Woodrow Wilson and FDR gave American liberals tools with which to respond to the coronavirus challenge. Even the new generation of American radicals led by Alexandria Ocasio-Cortez could find things to like about the New Deal.73 By
…
implications for our history—written from the safety of an Upper West Side apartment could seem remote. The Anthropocene remained an abstract intellectual proposition. The coronavirus crisis has stripped even the most sheltered of us of that illusion. Part I DISEASE X Chapter 1 ORGANIZED IRRESPONSIBILITY Skeptics—and there have been
…
system anywhere in the world that could absorb the caseload of a runaway pandemic. Organized irresponsibility ruled. * * * — As bewildering as its impact was, the 2020 coronavirus crisis was an accident waiting to happen. Not only did our modern way of life supercharge the mutation of potentially dangerous viruses, we carry them
…
-term perspective, and to strengthen and firm up confidence.” The emphasis now was on selectivity and discipline. About half of China’s counties had no coronavirus cases. There, the priority should be “on forestalling imported cases and comprehensively restoring the order of production and life.” For medium-risk regions, the
…
adequacy of public health systems but transatlantic divisions between the United States and Europe, over trade, NATO, and climate policy. Those who were warning about coronavirus, including the WHO boss Tedros Adhanom Ghebreyesus and Kristalina Georgieva of the IMF, struggled to make themselves heard. The main stage was given over to
…
bathrooms, kitchens, or washing facilities—the dilemmas were even more acute. In a labor market hierarchy that, in any case, rewards abstract, disembodied labor, the coronavirus crisis massively compounded existing inequalities. If you had the capacity to extract yourself, you were okay. You could work remotely. You could shop remotely. You
…
of hyperglobalization, fragile and attenuated welfare states, profound social and economic inequality, and the overweening size and influence of private finance. * * * — The fiscal response to coronavirus was a striking expression of combined and uneven development. On the one hand, since virtually every country in the world joined the collective move to
…
Central banks go on a bond-buying spree to support government responses to the pandemic. Data compiled by Bloomberg, https://www.bloomberg.com/graphics/2021-coronavirus-global-debt The central banks didn’t, on the whole, buy the newly issued debt directly. They bought bonds held by banks and investment funds
…
the stock market. It increased financial net worth and boosted demand. The supportive cooperation between central banks and treasuries in the common struggle against the coronavirus was thus, the central bankers adamantly insisted, no more than an incidental side effect of their frantic and clumsy efforts to manage the economy by
…
value; this was priced to panic.”3 How would the emerging markets weather the storm? Would a financial crisis cripple their ability to respond to coronavirus? Would the advanced economies and the international financial institutions, in which the Americans and Europeans have a controlling voice, offer assistance, or would they
…
compound the pressure? The coronavirus crisis was a major test of the economic regime not just of the advanced economies, but of the entire world. * * * — The capital flight of
…
were watching the generous social spending of Bolsonaro’s government with increasing apprehension. How, they asked, would a populist administration respond to another wave of coronavirus?73 More and more investors were willing to buy only short-dated Brazilian debt.74 The new toolkit for managing the risks of financial globalization
…
of the court, but away from it, not putting European solidarity in question, but tending, instead, to reinforce it. * * * — As a near-universal experience, the coronavirus pandemic concentrated minds across the world on a single issue, inducing identification, comparison, and sympathy across borders—Chen’s convergence, linkage, induction, and amplification effects
…
sector unions.30 His hobbyhorse was a liability shield, which would enable an early return to work while protecting employers against lawsuits to do with coronavirus infection. As a license for corporate irresponsibility, this would never pass the Democratic majority in the House.31 President Trump added noise to the
…
vaccine whose efficacy and safety had been legitimately tested and whose production was ramped up to scale were very different things. The drama of the coronavirus vaccine was that for the first time, all three processes—development, testing, ramping up production—were accomplished simultaneously, on a scale intended in due
…
Home,” Responsible Statecraft, June 4, 2020. 76. J. Iadarola, “What if Bernie Has Already Won This Thing?” The Hill, February 23, 2020. S. Hamid, “The Coronavirus Killed the Revolution,” Atlantic, March 25, 2020. 77. G. Ip, “Businesses Fret Over Potential Bernie Sanders Presidency,” Wall Street Journal, March 1, 2020. B. Schwartz
…
”; ecpr.eu/Filestore/PaperProposal/0dac228d-63fb-45c6-8384-21d764abaf6a.pdf. 37. A. Folley, “Texas Lt Gov: ‘Grandparents “Don’t Want the Whole Country Sacrificed” Amid Coronavirus Closures,’ ” The Hill, March 23, 2020. 38. C. Landwehr, “Deciding How to Decide: The Case of Health Care Rationing,” Public Administration 87, no. 3 (
…
Scramble to Avert a Chernobyl Moment,” Washington Post, January 29, 2020. J. Anderlini, “Xi Jinping Faces China’s Chernobyl Moment,” Financial Times, February 10, 2020. “Coronavirus ‘Cover-up’ Is China’s Chernobyl—White House Advisor,” Reuters, May 24, 2020. 5. J. Li, “Chinese People Are Using ‘Chernobyl’ to Channel Their
…
Shutdown Is Believed to Be Without Precedent,” New York Times, January 22, 2020. 16. R. McGregor, “China’s Deep State: The Communist Party and the Coronavirus,” Lowy Institute, July 23, 2020. 17. T. Heberer, “The Chinese ‘Developmental State 3.0’ and the Resilience of Authoritarianism,” Journal of Chinese Governance 1,
…
February 24, 2020. 61. “WHO Director-General Opening Remarks at the Media Briefing on COVID-19,” World Health Organization, February 23, 2020. 62. F. Tang, “Coronavirus: Xi Jinping Rings Alarm on China Economy as Country Shifts Priority to Maintaining Growth,” South China Morning Post, February 24, 2020. 63. R. McMorrow, N
…
M. MacKenzie, “In No Mood for Catching a Falling Knife,” Financial Times, February 25, 2020. 38. R. Wigglesworth, K. Martin, and T. Stubbington, “How the Coronavirus Shattered Market Complacency,” Financial Times, February 28, 2020. 39. MacKenzie, “In No Mood for Catching a Falling Knife.” 40. S. Johnson, “Global Inventories at 7
…
South Korea’s Rapid Response to the COVID-19 Pandemic,” Transportation Research Interdisciplinary Perspectives 5 (2020): 100111. 46. Herszenhorn and Wheaton, “How Europe Failed the Coronavirus Test.” 47. L. Kudlow and K. Evans, CNBC interview transcript, February 25, 2020; www.cnbc.com/2020/02/25/first-on-cnbc-cnbc-transcript-national
…
Trump Visits CDC, Calls Jay Inslee a ‘Snake,’ ” Rev, March 6, 2020. 53. D. Agren, “Mexican Governor Prompts Outrage with Claim Poor Are Immune to Coronavirus,” Guardian, March 26, 2020. 54. “Mexico: Mexicans Need Accurate COVID-19 Information,” Human Rights Watch, March 26, 2020. 55. F. Ng’wanakilala, “Tanzanian President
…
M. Fletcher, “Britain and Covid-19: A Chronicle of Incompetence,” New Statesman, July 1, 2020. 58. J. Horowitz, “The Lost Days That Made Bergamo a Coronavirus Tragedy,” New York Times, November 29, 2020. CHAPTER 4. MARCH: GLOBAL LOCKDOWN 1. P. Smith, “An Overview and Market Size of Tradable Commodities,” The Tradable
…
, “China Laps U.S. in Latin America with Covid-19 Diplomacy,” Bloomberg, June 24, 2020. 52. L. Paraguassu and J. McGeever, “Brazil Government Ad Rejects Coronavirus Lockdown, Saying #BrazilCannotStop,” Reuters, March 27, 2020. 53. “Federal Judge Bans Bolsonaro’s ‘Brazil Cannot Stop’ Campaign,” teleSUR, March 28, 2020. 54. D. Agren, “
…
56. Morning Conference with A. M. López Obrador, “Versión estenográfica de la conferencia de prensa matutina,” March 11, 2020. 57. T. Phillips, “Mexican President Ignores Coronavirus Restrictions to Greet El Chapo’s Mother,” Guardian, March 30, 2020. 58. R. Costa and P. Rucker, “Inside Trump’s Risky Push to Reopen the
…
A. Olson and C. Bussewitz, “Child Care Crisis Pushes US Mothers Out of the Labor Force,” AP News, September 4, 2020. 35. M. Paxton, “The Coronavirus Threat to Wildlife Tourism and Conservation,” United Nations Development Programme, April 21, 2020. “Global Wildlife Tourism Generates Five Times More Revenue Than Illegal Wildlife Trade
…
Conservation.” 38. J. K. Elliot, “Thailand’s ‘Monkey City’ Overrun by Gangs of Hungry, Horny Macaques,” Global News, June 24, 2020. 39. D. Jones, “The Coronavirus Pandemic Has Halted Tourism, and Animals Are Benefiting from It,” Washington Post, April 3, 2020. 40. M. Toyana, “Jobs Gone, Investments Wasted: Africa’s Deserted
…
Stracqualursi and A. Kurtz, “Trump Administration Asking States to Delay Release of Unemployment Numbers,” CNN, March 20, 2020. 61. G. Iacurci, “Job Losses Remain ‘Enormous’: Coronavirus Unemployment Claims Are Worst in History,” CNBC, July 9, 2020. 62. “2020: Charts from a Year Like No Other,” Financial Times, December 29, 2020. 63
…
M. Ashworth, “Germany’s ‘Black Zero’ Rule May Be Gone Forever,” Bloomberg, February 26, 2020. 14. M. Nienaber, “German Parliament Suspends Debt Brake to Fight Coronavirus Outbreak,” Reuters, March 25, 2020. 15. G. Chazan, “Scholz Insists Record German Borrowing Manageable,” Financial Times, June 17, 2020. “Germany Opens the Money Tap,” Economist
…
—China’s Recovery and International Response,” ODI Economic Pulse series, November 2020. 19. J. Sipalan, “Malaysia Announces $58-Billion Stimulus Package to Cushion Impact of Coronavirus,” Reuters, March 27, 2020. 20. J. Follain, “Italian Leader Takes to Basement to Plot How to Fight Virus,” Bloomberg, March 9, 2020. 21. J.
…
of Retail Investors Are Trading with Leverage,” Yahoo!, September 9, 2020. CHAPTER 8. THE TOOLKIT 1. J. Wheatley and A. Schipani, “Bolsonaro, Brazil and the Coronavirus Crisis in Emerging Markets,” Financial Times, April 19, 2020. “COVID-19 and Global Capital Flows,” Organisation for Economic Co-operation and Development, July 3, 2020
…
. 2. http://www.worldgovernmentbonds.com/cds-historical-data/brazil/5-years/. 3. Wheatley and Schipani, “Bolsonaro, Brazil and the Coronavirus Crisis in Emerging Markets.” 4. “Global Financial Stability Report,” International Monetary Fund, October 2019. 5. D. Gabor, “The Wall Street Consensus,” SocArXiv, July 2,
…
,” Financial Times, April 17, 2020. 51. G. Long, “Ecuador Takes Far-Reaching Measures to Save Economy,” Financial Times, May 20, 2020. 52. M. Stott, “Coronavirus Set to Push 29m Latin Americans into Poverty,” Financial Times, April 27, 2020. 53. “Peru Is Heading Towards a Dangerous New Populism,” Economist, July 25
…
, June 17, 2020. 64. “Brazil Faces Hard Spending Choices in 2021,” Economist, December 16, 2020. 65. M. Viotti Beck and A. Rosati, “Brazil’s Coronavirus Splurge Is Sparking a Rebellion in Markets,” Bloomberg, October 27, 2020. 66. B. Harris, “Brazil’s Economy Rebounds in Third Quarter,” Financial Times, December 3
…
been twitter.com/70sBachchan. 54. A. Thompson, “A Running List of Record-Breaking Natural Disasters in 2020,” Scientific American, December 22, 2020. 55. T. Fuller, “Coronavirus Limits California’s Efforts to Fight Fires with Prison Labor,” New York Times, August 22, 2020. 56. J. Poushter and C. Huang, “Despite Pandemic, Many
…
D. Diamond, “The Crash Landing of ‘Operation Warp Speed,’ ” Politico, January 17, 2021. 29. LaFraniere et al., “Politics, Science and the Remarkable Race for a Coronavirus Vaccine.” 30. B. Pancevski, “Germany Boosts Investment in Covid-19 Vaccine Research,” Wall Street Journal, September 15, 2020. 31. “Germany: Investment Plan for Europe—EIB
…
for COVID-19 Vaccine Development and Manufacturing,” European Investment Bank, June 11, 2020. 32. LaFraniere et al., “Politics, Science and the Remarkable Race for a Coronavirus Vaccine.” 33. L. Facher, “Amid Broad Mistrust of FDA and Trump Administration, Drug Companies Seek to Reassure Public About Covid-19 Vaccine Safety,” Stat, September
…
and M. DeBonis, “How Moonshine, Multi-Hour Zooms and a Deadly Pandemic Pushed Congress to Approve New Stimulus,” Washington Post, December 22, 2020. C. Hulse, “Coronavirus Stimulus Bolsters Biden, Shows Potential Path for Agenda,” New York Times, December 21, 2020. 7. www.youtube.com/watch?v=qOOPzkHF6yc. N. Rummell, “Intercession of
…
), 129 Moody’s rating agency, 166, 257–58, 270 Moore, Stephen, 76 Morawiecki, Mateusz, 280 Moreno, Lenín, 8, 168 Morin, Edgar, 6 mortality rates of coronavirus pandemic, 28, 36–37, 37–41, 169, 171 mortgage-backed securities, 14, 113–15, 117, 122, 129, 144 mRNA technology, 244, 246, 289 Müller,
by Colin Kahl and Thomas Wright · 23 Aug 2021 · 652pp · 172,428 words
News, May 30, 2020, https://www.nbcnews.com/politics/donald-trump/trump-says-he-postponing-g7-summit-n1219896. 4. Johns Hopkins University & Medicine, Coronavirus Research Center, https://coronavirus.jhu.edu/; International Monetary Fund, “Transcript of the World Economic Outlook Press Briefing,” January 26, 2021, https://www.imf.org/en/News/Articles/
…
-briefing. 5. “United States: Cumulative Confirmed Deaths: How Do They Compare to Other Countries?” Our World in Data, accessed March 30, 2021, https://ourworldindata.org/coronavirus/country/united-states. 6. Colin H. Kahl, States, Scarcity, and Civil Strife in the Developing World (Princeton, NJ: Princeton University Press, 2006). 7. Thomas
…
.com/articles/world/2020-06-09/when-system-fails. 5. COVID-19 Dashboard, Center for Systems Science and Engineering, Johns Hopkins University & Medicine, Coronavirus Resource Center, https://coronavirus.jhu.edu/map.html, accessed May 5, 2021. 6. Walter Scheidel, “The Spanish Flu Didn’t Wreck the Global Economy,” Foreign Affairs, May
…
Osterholm and Mark Olshaker, “Chronicle of a Pandemic Foretold,” Foreign Affairs, July/August 2020, 19, https://www.foreignaffairs.com/articles/united-states/2020-05-21/coronavirus-chronicle-pandemic-foretold. 12. Mapping the Global Future: Report of the National Intelligence Council’s 2020 Project (Washington, DC: National Intelligence Council, 2004), 9–
…
. 30. World Health Organization, transcript, “Virtual Press Conference on COVID-19,” March 11, 2020, 14, https://www.who.int/docs/default-source/coronaviruse/transcripts/who-audio-emergencies-coronavirus-press-conference-full-and-final-11mar2020.pdf?sfvrsn=cb432bb3_2. 31. Interview with David Fidler, March 8, 2021. 32. Xiaolin Wei, “China’s
…
David Bandurski, “Whistling Against Deception,” China Media Project, March 11, 2020, http://chinamediaproject.org/2020/03/11/whistling-against-deception/. 43. Whittell, “The Disappeared.” 44. “Coronavirus: Why Have Two Reporters in Wuhan Disappeared?,” BBC, February 14, 2020, https://www.bbc.com/news/world-asia-china-51486106. 45. Bill Bishop, “Another Standing
…
Exclusive: Internal Chinese Report Warns Beijing Faces Tiananmen-Like Global Backlash over Virus—Sources,” Reuters, May 4, 2020, https://uk.reuters.com/article/uk-health-coronavirus-china-sentiment-ex/exclusive-internal-chinese-report-warns-beijing-faces-tiananmen-like-global-backlash-over-virus-sources-idUKKBN22G198. 75. China Global Television Network, “Zhong Nanshan
…
: With Covid, China Took a Leading Role,” Associated Press, February 15, 2021, https://apnews.com/article/pandemics-beijing-only-on-ap-epidemics-media-122b73e134b780919cc1808f3f6f16e8. 82. “Coronavirus: China Accuses US of Spreading ‘Conspiracies,’” BBC, May 24, 2020, https://www.bbc.com/news/world-asia-china-52790634. 83. Hua Chunying 华春莹 (@SpokespersonCHN), “#Pompeo
…
, Laura Kayali, and Laurens Cerulus, “European Commission Accuses China of Peddling Disinformation,” Politico, June 10, 2020, https://www.politico.eu/article/european-commission-disinformation-china-coronavirus/. 92. Yang, “China’s Early Warning System.” 93. Whittell, “The Disappeared.” 94. Yao Yang, “Is a New Cold War Coming?,” interview with Beijing Cultural
…
_beyond_the_pandemic. 15. Maurizio Massari, “Italian Ambassador to the EU: Italy Needs Europe’s Help,” Politico, March 10, 2020, https://www.politico.eu/article/coronavirus-italy-needs-europe-help/. 16. Europe Elects (@EuropeElects), “Italy: Tecnè poll,” Twitter, April 11, 2020, 5:00 p.m., https://twitter.com/europeelects/status
…
,” Financial Times, April 16, 2020, https://www.ft.com/content/3ea8d790-7fd1-11ea-8fdb-7ec06edeef84. 32. Schmitt-Roschmann, “After Glimpsing ‘Abyss’”; Rinke and Wacket, “Coronavirus Pandemic Is Historical Test”; Sánchez, “Europe’s Future Is at Stake”; Mallet and Khalaf, “FT Interview: Emmanuel Macron.” 33. Martin Wolf, “German Court Decides to
…
Lee, “Taiwan’s New ‘Electronic Fence’ for Quarantines Leads Wave of Virus Monitoring,” Reuters, March 20, 2020, https://www.reuters.com/article/us-health-coronavirus-taiwan-surveillanc/taiwans-new-electronic-fence-for-quarantines-leads-wave-of-virus-monitoring-idUSKBN2170SK; interviews with government officials of Taiwan. 40. “Taiwan Can Help, and
…
/; Rocky Swift, “Study Links Japan’s Domestic Travel Campaign to Increased COVID-19 Symptoms,” Reuters, December 8, 2020, https://www.reuters.com/article/health-coronavirus-japan-travel/study-links-japans-domestic-travel-campaign-to-increased-covid-19-symptoms-idUSKBN28I17C; Sho Saito, Yusuke Asai, and Nobuaki Matsunaga, “First and Second COVID
…
-3/fulltext; Bloomberg Quicktake (@Quicktake), “WATCH: Thousands of people in Brazil banged pots from their balconies in protest against President Bolsonaro’s handling of the #coronavirus pandemic,” Twitter, March 19, 2020, 10:00 p.m., https://twitter.com/QuickTake/status/1240820403435700226?s=20. 54. Antonia Noori Farzan and Miriam Berger,
…
77. Vanessa Molter, “Virality Project (China): Pandemics & Propaganda,” Stanford Cyber Policy Center, March 19, 2020, https://cyber.fsi.stanford.edu/news/chinese-state-media-shapes-coronavirus-convo; Rachel Kleinfeld, “Do Authoritarian or Democratic Countries Handle Pandemics Better?,” Carnegie Endowment for International Peace, March 31, 2020, https://carnegieendowment.org/2020/03/31
…
Sawyer Crosby, and Samantha Kiernan, “Fighting a Pandemic Requires Trust,” Foreign Affairs, October 23, 2020, https://www.foreignaffairs.com/articles/united-states/2020-10-23/coronavirus-fighting-requires-trust. 80. Migone, “The Influence of National Policy Characteristics”; “The Politics of Pandemics: Why Some Countries Respond Better Than Others,” Knowledge@Wharton, May
…
=premium&sref=bxQtWDnd. 19. Author interview with three European Central Bank officials, February 12, 2021. 20. Randow and Skolimowski, “Christine Lagarde’s $810 Billion Coronavirus U-Turn.” 21. “Interview with Christine Lagarde, President of the ECB, Conducted by Matthieu Pelloli and Published on 9 April 2020,” European Central Bank, April
…
com/content/f8efe708-3c22-493b-88bd-855ec6d98522; Danica Kirka, “UK Economy Suffers Biggest Drop Since 1709,” Associated Press, February 12, 2021, https://apnews.com/article/coronavirus-pandemic-economy-4f0b6285a57c8b2929e2aceb864e7675; Prinesha Naidoo, “S. Africa Virus-Hit Economy Shrank Most in 100 Years in 2020,” Bloomberg, March 9, 2021, https://www.bloomberg.com
…
Student Enrollment Snapshot,” Institute of International Education, November 2020, https://www.iie.org/Research-and-Insights/Open-Doors/Fall-International-Enrollments-Snapshot-Reports; Peter Hurley, “Coronavirus and International Students,” Mitchell Institute at Victoria University, October 2020, https://www.vu.edu.au/sites/default/files/international-student-update-2020-mitchell-institute.pdf
…
-bangladeshs-garment-industry/a-53895339. 2. Quoted in Rebecca Wright and Salman Saeed, “Bangladeshi Garment Workers Face Ruin as Global Brands Ditch Clothing Contracts amid Coronavirus Pandemic,” CNN Business, April 22, 2020, https://www.cnn.com/2020/04/22/business/bangladesh-garment-factories/index.html. 3. “Dhaka, Bangladesh Population,” Population
…
Paul, “Bangladesh Shuts Down Villages After Tens of Thousands Attend Cleric’s Funeral,” Reuters, April 20, 2020, https://www.reuters.com/article/us-health-coronavirus-bangladesh/bangladesh-shuts-down-villages-after-tens-of-thousands-attend-clerics-funeral-idUSKBN2220PA. 9. Kamran Reza Chowdhury, “COVID-19 Cases Soar in Bangladesh; Thousands Defy
…
2020. 12. Ruma Paul, “Garment Exporter Bangladesh Faces $6 Billion Hit as Top Retailers Cancel,” Reuters, March 31, 2020, https://www.reuters.com/article/health-coronavirus-bangladesh-exports/garment-exporter-bangladesh-faces-6-billion-hit-as-top-retailers-cancel-idUKKBN21I2R9. 13. “Helping Bangladesh Recover from COVID-19,” International Monetary Fund, June
…
11/bangladesh-to-resume-international-flights-on-june-16. 33. COVID-19 Dashboard, Center for Systems Science and Engineering, Johns Hopkins University & Medicine, Coronavirus Resource Center, https://coronavirus.jhu.edu/map.html, accessed December 26, 2020. 34. Shaina Ahluwalia and Anurag Maan, “South Asia Reached 10 Million COVID-19 Cases—Reuters
…
imf.org/en/Publications/WEO/%20Issues/2021/01/26/2021-world-economic-outlook-update. 98. Claudia Viale, “Peru: Updated Assessment of the Impact of the Coronavirus Pandemic on the Extractive Sector and Resource Governance,” Natural Resource Governance Institute, December 18, 2020, https://resourcegovernance.org/analysis-tools/publications/peru-updated-assessment-impact
…
Surge Among Refugees in Middle East as Pandemic Pushes Most Vulnerable Deeper into Poverty,” Independent, September 20, 2020, https://www.independent.co.uk/independentpremium/world/coronavirus-cases-surge-among-refugees-middle-east-pandemic-pushes-most-vulnerable-deeper-poverty-b506833.html. 93. Dempster et al., “Locked Down and Left Behind.” 94
…
Berger, “Refugee Camps Have Avoided the Worst of the Pandemic.” 96. Quoted in Raquel Carvalho, “Rohingya Refugees in Bangladesh Struggle with Fear and Stigma amid Coronavirus,” South China Morning Post, September 13, 2020, https://www.scmp.com/week-asia/health-environment/article/3101271/rohingya-refugees-bangladesh-struggle-fear-and-stigma.
…
, “Protesters Paralyze Bolivia over Election Delays, Threaten Escalation,” Washington Post, August 12, 2020, https://www.washingtonpost.com/world/the_americas/bolivia-protest-blockade-anez-evo-coronavirus/2020/08/11/7ffceb50-db48-11ea-809e-b8be57ba616e_story.html. 24. Trigo, Kurmanaev, and McCann, “As Politicians Clashed, Bolivia’s Pandemic Death Rate Soared.”
…
deploys-drones-cameras-loudhailers-chastise-people/story?id=68746989; Yujing Liu, “China Adapts Surveying, Mapping, Delivery Drones to Enforce World’s Biggest Quarantine and Contain Coronavirus Outbreak,” South China Morning Post, March 5, 2020, https://www.scmp.com/business/china-business/article/3064986/china-adapts-surveying-mapping-delivery-drones-task.
…
Enforce the Country’s Lockdown After the Mayor Worried Residents Weren’t Taking Containment Measures Seriously,” Business Insider, March 20, 2020, https://www.businessinsider.com/coronavirus-drones-france-covid-19-epidemic-pandemic-outbreak-virus-containment-2020-3; Helene Fouquet and Gaspard Sebag, “French Covid-19 Drones Grounded After Privacy Complaint,” Bloomberg
…
.wsj.com/articles/beijing-ousts-four-opposition-lawmakers-in-hong-kong-11605080352; Repucci and Slipowitz, Democracy Under Lockdown, 10. 57. Faiola, Wessel, and Mahtani, “Coronavirus Chills Protests”; Chenoweth et al., “The Global Pandemic Has Spawned New Forms of Activism—and They’re Flourishing.” 58. Charis McGowan, “How Quarantined Chileans Are
…
-and-economic-trends-in-urban-suburban-and-rural-communities/; Elise Gould and Valerie Wilson, “Black Workers Face Two of the Most Lethal Preexisting Conditions for Coronavirus—Racism and Economic Inequality,” Economic Policy Institute, 2020, https://www.epi.org/publication/black-workers-covid/; Emily Benfer and Lindsay Wiley, “Health Justice Strategies
…
; Brenda Goodman, “Where Do COVID Vaccines Stand Against the Variants?,” Medscape, March 29, 2021, https://www.medscape.com/viewarticle/948335. 8. Corum and Zimmer, “Coronavirus Variants and Mutations.” 9. “Total Confirmed Cases of COVID-19,” Our World in Data, accessed February 17, 2021, https://ourworldindata.org/grapher/cumulative-covid-cases
…
Mid-June,” Politico, May 13, 2020, https://www.politico.eu/article/germany-eases-border-checks-but-some-restrictions-will-remain-until-mid-june-coronavirus-covid19/. 14. European Commission, “Coronavirus: Commission Recommends Partial and Gradual Lifting of Travel Restrictions to the EU After 30 June, Based on Common Coordinated Approach,” press release,
…
-security-financing/. 61. Jillian Deutsch and Sarah Wheaton, “How Europe Fell Behind on Vaccines,” Politico, January 27, 2021, https://www.politico.eu/article/europe-coronavirus-vaccine-struggle-pfizer-biontech-astrazeneca/. 62. Deutsch and Wheaton, “How Europe Fell Behind on Vaccines”; Jacob Funk Kirkegaard, “The European Union’s Troubled COVID-19
…
to Limit Vaccine Exports.” 72. Rym Momtaz, “Macron: AstraZeneca Vaccine Seems ‘Quasi-Ineffective’ on Older People,” Politico, January 29, 2021, https://www.politico.eu/article/coronavirus-vaccine-europe-astrazeneca-macron-quasi-ineffective-older-pe/. 73. European Medicines Agency, “EMA Recommends COVID-19 Vaccine AstraZeneca for Authorisation in the EU,” January 29
…
, 2020, https://www.washingtonpost.com/world/vaccine-russia-china-influence/2020/11/23/b93daaca-25e5-11eb-9c4a-0dc6242c4814_story.html; Mark Scott, “In Race for Coronavirus Vaccine, Russia Turns to Disinformation,” Politico, November 19, 2020, https://www.politico.eu/article/covid-vaccine-disinformation-russia/; Lili Bayer and Jillian Deutsch, “Hungary
…
March 27, 2021, https://www.nytimes.com/2021/03/27/world/americas/virus-brazil-bolsonaro.html. 89. Quoted in Mauricio Savarese, “Brazil’s Bolsonaro Rejects Coronavirus Vaccine from China,” AP News, October 21, 2020, https://apnews.com/article/virus-outbreak-brazil-state-governments-health-sao-paulo-b7b5b620ba54f402dbf803e26fe6b842. 90. Antonia Noori Farzan
…
and Heloísa Traiano, “U.S. Officials Pushed Brazil to Reject Russia’s Coronavirus Vaccine, According to HHS report,” Washington Post, March 16, 2021, https://www.washingtonpost.com/world/2021/03/16/hhs-brazil-sputnik-russia/. 91. Eduardo
…
Macaya, Melissa Mathani, and Fernando Alfonso III, “October 2: Trump’s Covid Diagnosis,” CNN, October 2, 2020, https://www.cnn.com/politics/live-news/trump-coronavirus-positive/h_cebb891fe9fe8513948709d5f1793e07. 95. Jeff Mason and Joseph Ax, “Chaotic Clash in Cleveland: Five Takeaways from First U.S. Presidential Debate,” Reuters, September 29,
…
-international-health-architecture; “U.S., China Positive on Pandemic Treaty Idea: WHO’s Tedros,” Reuters, March 30, 2021, https://www.reuters.com/article/us-health-coronavirus-treaty-members-idUSKBN2BM10T. 35. Burwell et al., “Improving Pandemic Preparedness: Lessons from COVID-19,” 78–79, 89–92. 36. World Health Organization, “International Health
…
Adhanom Ghebreyesus third wave (of autocratization) Tillerson, Rex Tooze, Adam Troye, Olivia Trump, Donald “America First” platform Bolsonaro, Jair, and cancellation of 2020 G7 summit Coronavirus Task Force COVID-19 response COVID-19 vaccine development and on “deep state” downplaying of COVID-19 Helsinki summit Johnson, Boris, and Macron, Emmanuel, and
by Mollie Hemingway · 11 Oct 2021 · 595pp · 143,394 words
more valid in 2020, an election year unlike any other in American history. In the lead-up to the election, thanks in part to the coronavirus pandemic that gripped the world, wide-ranging electoral reforms were implemented. Across the country at the state, local, and federal levels, political actors rammed
…
and the building of walls.”114 STAT, a health and medicine news site, ran a piece headlined, “Health Experts Warn China Travel Ban Will Hinder Coronavirus Response,” and said the ban was desired by “conservative lawmakers and far-right supporters of the president,” even as “public health experts… warn that the
…
doing too little, members of the media tried to rewrite recent history. Politico’s Dan Diamond retroactively claimed, “[I]n late January, Trump’s initial coronavirus moves were widely hailed as [a] strong and appropriate response.”117 Early on, though, the conventional wisdom was that there was no need to panic
…
Moody’s Analytics model that showed him a strong favorite to win.124 By March, the realization among Democrats and their media allies that the coronavirus outbreak was much more serious than they had previously thought coincided with the realization that they could benefit politically from a pandemic. Once Trump opponents
…
News added, “Frequent hand-washing, not wearing a face mask, is the most important step the public can take to prevent the spread of the coronavirus, the World Health Organization said.”134 Naturally, the bureaucrats’ anti-mask message was contrasted with Trump’s willingness to cast about for a wide variety
…
spreading false hope for a virus cure—and that’s not the only damage,” the Washington Post opined.143 “Trump is spreading misinformation about the coronavirus—time to take away his microphone. Cable news networks should stop airing the president’s COVID-19 press conferences live,” argued the Boston Globe.144
…
contribution had gone to a “pro-science super PAC.”148 Finally, the politicized reaction started to impact the medical community’s ability to objectively assess coronavirus treatments. A study that had concluded hydroxychloroquine was dangerous to patients received much media coverage. Then the journal The Lancet pulled it because the authors
…
media favorite list. In particular, the media were obsessed with the daily press conferences held by Cuomo, leader of the state hit hardest by the coronavirus. Anyone paying attention would have noticed that Cuomo frequently agreed with the president. After harshly criticizing Trump for saying hydroxychloroquine had promise, the media didn
…
pandemic crisis.” Politico barely stopped itself from putting actual profanity in a headline: “ ‘Dumbest S—’: DeSantis Takes Heat as He Goes His Own Way on Coronavirus.” Unlike Cuomo, DeSantis not only made the correct call not to return COVID-19 patients to nursing homes, but Florida significantly outperformed New York in
…
both per capita coronavirus cases and deaths in the state. * * * Even though the evidence showed China’s communist government, aided by an incompetent and credulous World Health Organization,
…
a “China virus” or “Wuhan virus” was xenophobic, it represented yet another shameless about-face. Media outlets had already spent months referring to the “Wuhan coronavirus” and various other names that clearly reflected the virus’s foreign origin. On March 12, the conservative Media Research Center put together a video showing
…
“we’re starting to see a message shift here because you’re starting to hear the Republicans, especially Trump, call it the ‘Wuhan’ or ‘Chinese coronavirus.’ They’re looking for someone to blame.” Cuomo’s insipid observation was then followed by nearly two minutes of clips from media figures, including several
…
CNN journalists, referring over the previous two months to the “Wuhan” or “Chinese coronavirus.”160 But the media’s shamelessness persisted. Instead of focusing on public health questions during daily White House press briefings, the press feigned outrage over
…
to the public, as had been long suspected. One email showed Peter Daszak, president of EcoHealth Alliance, thanking Fauci for publicly dismissing concerns that the coronavirus was created in a lab. EcoHealth Alliance has worked with the Wuhan Institute of Virology. In an email, Fauci also dismissed the idea that the
…
helped support that message. Whether it was the cause or effect of the messaging focus, polls showed that Democrats were much more terrified of the coronavirus than Republicans were.8 As important as a virtual convention was to Democratic messaging, an in-person convention was for Republicans. Trump repeatedly emphasized that
…
Hicks, who had traveled with the president at least three times in the previous week and participated in debate prep, had tested positive for the coronavirus.40 After midnight, Trump tweeted that he and Melania had tested positive and would begin their quarantine and recovery process immediately.41 It was a
…
very strong start to the vice-presidential debate, with a rehearsed but very effective answer criticizing the Trump administration for its failure to bring the coronavirus epidemic to heel. But when pressed for details on what she’d do differently, she struggled and never quite regained a strong footing. She
…
pay for the parts of Democrats’ mail-in ballot strategy that state and local governments themselves could do, claiming it was necessary because of the coronavirus. Congress allocated hundreds of millions of dollars, but the progressive activists needed much more to accomplish their vision. That’s when “[p]rivate philanthropy
…
Bay, Madison, Milwaukee, and Kenosha to ensure voting could be “done in accordance with prevailing public health requirements” to “reduce the risk of exposure to coronavirus.”119 Wisconsin law says voting is a right, but that voting absentee is a privilege. “[V]oting by absentee ballot must be carefully regulated to
…
was downplayed in favor of liberals’ alleging Trump was racist.49 Just as the 2020 general election campaign got going, media-induced hysteria over the coronavirus sent not just the country but the world into a tailspin. Any attempt to hold the communist government of China accountable for unleashing the virus
…
any election loss, but what Democrats did to the manner in which people vote was further destabilizing to the country. Democrats took advantage of the coronavirus global pandemic to foist upon the country election rules explicitly designed to favor their party. Since before the country was founded, Americans have been fighting
…
as Emergency Fed Action Fails to Mollify Investors,” Washington Post, March 16, 2020, https://www.washingtonpost.com/business/2020/03/16/stocks-markets-live-updates-coronavirus/. 14. “A Timeline of COVID-19 Developments in 2020,” American Journal of Managed Care, updated January 1, 2021, https://www.ajmc.com/view/a-
…
Election Puts Poll Workers at Risk of Virus,” New York Times, April 2, 2020, https://www.nytimes.com/2020/04/02/us/politics/wisconsin-election-coronavirus.html. 24. Alex Seitz-Wald and Shaquille Brewster, “GOP Lawmakers Reject Wisconsin Governor’s Call for Delay in Election Results,” NBC News, April 3,
…
State’s Latest Whipsaw,” Washington Post, April 7, 2020, https://www.washingtonpost.com/politics/wisconsin-governor-suspends-in-person-voting-in-tuesdays-elections-amid-escalating-coronavirus-fears/2020/04/06/9d658e2a-781c-11ea-b6ff-597f170df8f8_story.html. 26. Laurel White, “Postmark Irregularities Could Disqualify Ballots Sent on or before Election Day
…
Lisa Lerer, “Wisconsin Votes Tomorrow. In Person,” New York Times, April 6, 2020, https://www.nytimes.com/2020/04/06/us/politics/on-politics-wisconsin-coronavirus.html. 28. John McCormack, “CDC Study Shows No COVID-19 Spike from Wisconsin’s April Election,” National Review, July 31, 2020, https://www.nationalreview.com
…
/2020/07/cdc-study-wisconsin-elections-caused-no-coronavirus-spike/. 29. David Wahlberg, “No COVID-19 Surge in Milwaukee from Wisconsin’s April 7 Election, CDC Says,” Wisconsin State Journal, August 3, 2020,
…
, 2016,” Ballotpedia, n.d., https://ballotpedia.org/Wisconsin%27s_7th_Congressional_District_election. 43. Donald Judd, “Donald Trump Holds ‘Tele-Rally’ in Campaign First amid Coronavirus Pandemic,” CNN, July 18, 2020, https://www.cnn.com/2020/07/18/politics/donald-trump-telerally-campaign-event/index.html. 44. Bauer, “Trump-Backed Tom
…
, https://www.cbsnews.com/news/georgia-postpones-presidential-primary-scheduled-for-march-24-2020-03-14/. 66. Ben Nadler, “Georgia Postpones Primaries Again because of Coronavirus,” Associated Press, April 9, 2020, https://apnews.com/article/public-health-primary-elections-us-news-ap-top-news-elections-d0a07a2989f7399c6b14e2276b482526. 67. Richard Fausset and Reid
…
strong and appropriate response…,” Twitter, March 8, 2020, 9:22 a.m., https://twitter.com/ddiamond/status/1236643371734765568. 118. Gerry Shih et al., “As Deadly Coronavirus Spreads, U.S. to Expand Screening of Passengers from China at 20 Airports,” Washington Post, January 27, 2020, https://www.washingtonpost.com/health/as-deadly
…
9:31 p.m., https://twitter.com/RepGosar/status/1242625203844325376. 120. Lenny Bernstein, “Get a Grippe, America. The Flu Is a Much Bigger Threat Than Coronavirus, for Now,” Washington Post, February 1, 2020, https://www.washingtonpost.com/health/time-for-a-reality-check-america-the-flu-is-a-much-bigger-threat
…
-government-health-agency-official-corona-virus-isnt-something-the. 122. KPIX CBS SF Bay Area, “Speaker Pelosi Visits SF’s Chinatown to Show Support amid Coronavirus Fears,” YouTube, February 24, 2020, https://www.youtube.com/watch?time_continue=134&v=eFCzoXhNM6c&feature=emb_title. 123. David Siders, “Dems Sweat Trump’
…
concerned/. 141. Stephen Collinson, “Trump Peddles Unsubstantiated Hope in Dark Times,” CNN, March 20, 2020, https://www.cnn.com/2020/03/20/politics/donald-trump-coronavirus-false-hope/index.html. 142. Elizabeth Cohen et al., “Trump Says This Drug Has ‘Tremendous Promise,’ but Fauci’s Not Spending Money on It,” CNN
…
thats-not-the-only-damage/2020/03/25/587b26d8-6ec3-11ea-b148-e4ce3fbd85b5_story.html. 144. Michael A. Cohen, “Trump Is Spreading Misinformation about the Coronavirus—Time to Take Away His Microphone,” Boston Globe, March 20, 2020, https://www.bostonglobe.com/2020/03/20/opinion/take-away-trumps-microphone/. 145. Sonam
…
Stress This Enough, This Will Kill You’: Fox News Host Neil Cavuto Was Shocked by Trump’s Announcement That He’s Taking Hydroxychloroquine to Prevent Coronavirus,” Business Insider, May 18, 2020, https://www.businessinsider.com/fox-news-neil-cavuto-shocked-trump-hyroxychloroquine-announcement-video-2020-5. 146. Erika Edwards and Vaughn
…
thedailybeast.com/trump-addresses-kung-flu-remark-says-asian-americans-agree-100-with-him-using-chinese-virus. 163. Kamala Harris (@VP), “Calling it the ‘Chinese coronavirus’ isn’t just racist, it’s dangerous and incites discrimination against Asian Americans and Asian immigrants…,” Twitter, March 10, 2020, 12:52 p.m., https
…
Masks. China Makes Them, but Has Been Hoarding Them,” New York Times, April 2, 2020, https://www.nytimes.com/2020/03/13/business/masks-china-coronavirus.html. 170. Helen Davidson, “First COVID-19 Case Happened in November, China Government Records Show—Report,” The Guardian, March 13, 2020, https://www.theguardian.
…
/1261338735355899906?lang=en. 185. “The Upside of Crisis,” Kite and Key Media, March 2021, https://www.kiteandkeymedia.com/videos/covid-19-crisis-management-federal-government-coronavirus-pandemic-emergency-vaccine/?utm_source=social&utm_medium=twitter. 186. NPR (@NPR), “Fact Check: President Trump said of a vaccine: ‘It’s ready. It’s
…
Owermohle, “Pfizer Trying to Defuse Critics amid Push for Vaccine before Election Day,” Politico, October 9, 2020, https://www.politico.com/news/2020/10/09/coronavirus-vaccine-pfizer-election-day-428371. 189. Matthew Herper, “COVID-19 Vaccine from Pfizer and BioNTech Is Strongly Effective, Early Data from Large Trial Indicate,” STAT
…
trump-calls-george-floyds-death-a-terrible-thing-2020-05-29/. 15. Scott Neuman, “Medical Examiner’s Autopsy Reveals George Floyd Had Positive Test for Coronavirus,” NPR, June 4, 2020, https://www.npr.org/sections/live-updates-protests-for-racial-justice/2020/06/04/869278494/medical-examiners-autopsy-reveals-george-floyd
…
-had-positive-test-for-coronavirus. 16. Akshita Jain, “George Floyd’s Killing Not a Hate Crime because It Was Systemic Not ‘Explicit’ Racism, Says Official,” The Independent, April 26,
…
-convention. 10. Dan Merica, Ryan Nobles, and Jeremy Diamond, “Trump Says GOP Forced to Find New State to Host Convention as North Carolina Stands by Coronavirus Measures,” CNN, June 3, 2020, https://www.cnn.com/2020/06/02/politics/republican-national-convention-location/index.html. 11. Jim Morrill, “The RNC
…
-superspreader-event-n1242781. 13. Elle Thomas, “Sen. Mike Lee Tests Positive for COVID-19,” FOX 13, October 2, 2020, https://www.fox13now.com/news/coronavirus/local-coronavirus-news/sen-mike-lee-tests-positive-for-covid-19. 14. Jonah Goldberg, “Ruth Bader Ginsburg and a Question of Eugenics,” Chicago Tribune, July 16, 2009
…
ct-xpm-2009-07-16-0907150564-story.html. 15. Tom Hamburger, “Two Students and a Teacher at School Attended by Barrett Children Test Positive for Coronavirus,” Washington Post, October 9, 2020, https://www.washingtonpost.com/politics/barrett-children-school-covid/2020/10/09/ac130298-0a40-11eb-9be6-cf25fb429f1a_story.html. 16
…
Will Be Hospitalized ‘for the Next Few Days,’ ” CNN, October 3, 2020, https://www.cnn.com/2020/10/02/politics/president-donald-trump-walter-reed-coronavirus/index.html. 47. Jennifer Rubin (@JRubinBlogger), “Totally unacceptable we have not heard from a doctor. Has the 25th amendment been invoked???,” Twitter, October 2,
…
of ‘Inflicting’ Failures on Americans,” Daily Caller, October 4, 2020, https://dailycaller.com/2020/10/04/get-well-get-it-together-jake-tapper-trump-failures-coronavirus/. 54. Barbara Sprunt, “Despite Risks to Others, Trump Leaves Hospital Suite to Greet Supporters,” NPR, October 4, 2020, https://www.npr.org/sections/latest-
…
. 173. Christina A. Cassidy, “Voter Outreach Led to Big Drop in Rejected Mail Ballots,” Associated Press, March 16, 2021, https://apnews.com/article/politics-wisconsin-coronavirus-pandemic-elections-atlanta-25b5218ee92dadf78be274211bef6c6b. 174. Litke, “Fact Check: Wisconsin’s November Absentee Rejection Rate Was in Line.” 175. Nathaniel Rakich, “Why So Few Absentee Ballots
by Edward Glaeser and David Cutler · 14 Sep 2021 · 735pp · 165,375 words
United States.” Almost 70 percent: US Bureau of Labor Statistics, “Labor Force Statistics from the Current Population Survey: Supplemental Data Measuring the Effects of the Coronavirus (COVID-19) Pandemic on the Labor Market.” only 5 percent of people: US Bureau of Labor Statistics, “Labor Force Statistics.” “any city, however small
…
Zone, Where Seattle Protesters Gather without Police.” The patricians who fled: Borà, “Historical and Monumental Itineraries of Capri.” In our own time, one of: “Coronavirus in the U.S.: Latest Map and Case Count,” The New York Times. long-term impairments: del Rio, Collins, and Malani, “Long-Term Health Consequences
…
Since 2016.” $16 trillion by the time: Cutler and Summers, “The COVID-19 Pandemic and the $16 Trillion Virus.” Pfizer and Moderna: Thomas, “The Coronavirus Vaccines Will Probably Work. Making Them Fast Will Be the Hard Part.” building of sewers and aqueducts: Ashraf, Glaeser, and Ponzetto, “Infrastructure, Incentives, and Institutions
…
. “stadtluft macht frei”: Glaeser, “City Air Makes You Free.” Los Angeles sharply restricts: Glaeser, “Reforming Land Use Regulations.” The stellar performance of New Zealand: “Coronavirus: How New Zealand Relied on Science and Empathy,” BBC News. “there’s no reason to be”: “Fact Check: Outdated Video of Fauci Saying ‘There’s
…
population died. At the time of publication, the case fatality rate of COVID-19 was estimated to be around 1 percent, as per Johns Hopkins Coronavirus Resource Center, “Mortality Analyses.” the city-state surrendered: “Peloponnesian War,” History.com. The first farming: Lieberman, The Story of the Human Body: Evolution, Health
…
by Race/Ethnicity—Issue Brief.” “dying like sheep”: Thucydides, book 2, 51. “carried away all alike”: Thucydides, book 2, 5. Unlike COVID-19: Johns Hopkins Coronavirus Resource Center, “Mortality Analyses.” “those with naturally strong . . . to resist the disease”: Thucydides, book 2, 51. “men, not knowing”: Thucydides, book 2, 52. “Athens
…
banned travel from China: “Proclamation on the Suspension of Entry as Immigrants and Non-Immigrants of Certain Additional Persons Who Pose a Risk of Transmitting Coronavirus Disease,” White House. “Veniens de locis”: In 1377, Ragusa passed legislation to “prevent the spread of the pandemic.” Vuković, “Dubrovnik: The Medieval City
…
Infectious Diseases by Clinicians.” waiting until the end of January: Chinazzi et al., “The Effect of Travel Restrictions on the Spread of the 2019 Novel Coronavirus (COVID-19) Outbreak.” The international body most responsible: Knowledge of the World Health Organization comes from “World Health Organization,” Encyclopædia Britannica Online. the WHO
…
investigations”: World Health Organization (@WHO), “Preliminary investigations conducted by the Chinese authorities have found no clear evidence of human-to-human transmission of the novel #coronavirus (2019-nCoV) identified in #Wuhan, #China.” echoed official Chinese information: The WHO reported on official Chinese government findings that “there is no clear evidence
…
also comes from Bollyky and Patrick. In January of 2021, China blocked: Regand and Sidhu, “WHO Team Blocked from Entering China to Study Origins of Coronavirus.” Membership in the WHO: World Health Organization, “Countries Overview.” “to guarantee the freedom”: North Atlantic Treaty Organization, “What Is NATO?” translated into strategic concepts:
…
Defence—Article 5.” CHAPTER 3: CAN INDIAN SEWERS MAKE INDIANA HEALTHIER? the pandemic was far deadlier: Adhikari et al., “Assessment of Community-Level Disparities in Coronavirus Disease 2019 (COVID-19) Infections and Deaths in Large US Metropolitan Areas.” costing trillions: Cutler and Summers, “The COVID-19 Pandemic and the $16
…
mischief”: Jameson, 11. “the disease put forth”: Jameson, 12. the reverse of the movement: Sagonowsky, “Biogen Superspreader Meeting Spawned 300,000-plus U.S. Coronavirus Cases: Study.” “after creeping about”: All quotes from this paragraph come from Jameson, 12–13. “there is an opinion”: All quotes in this paragraph come
…
single event”: Shanks and Brundage. Most pandemics are zoonotic: Olival et al., “Host and Viral Traits Predict Zoonotic Spillover from Mammals.” COVID-19 (bats): Mallapaty, “Coronaviruses Closely Related to the Pandemic Virus Discovered in Japan and Cambodia.” Ebola (bats): World Health Organization, “Ebola Virus Disease.” AIDS (chimpanzees): Sharp and Hahn, “
…
Than Suspected.” AIDS emerged in the Congo: Sample, “HIV Pandemic Originated in Kinshasa in the 1920s, Say Scientists.” COVID-19 had only: Taylor, “The Coronavirus Pandemic: A Timeline.” Domesticated animals are generally: “Eastern Equine Encephalitis Virus (EEEV): The Role of Diagnostics,” American Society for Microbiology. The Northeast of the US
…
and Memish, “MERS-CoV as an Emerging Respiratory Illness: A Review of Prevention Methods.” Malayan pangolins: Xiao et al., “Isolation of SARS-CoV-2-Related Coronavirus from Malayan Pangolins.” “elevated metabolic”: Schountz, “Immunology of Bats and Their Viruses: Challenges and Opportunities.” consumption of disease-ridden insects: Gorman, “How Do Bats
…
Live With So Many Viruses?” Calisher et al., “Bats: Important Reservoir Hosts of Emerging Viruses.” “it is highly likely”: Fan et al., “Bat Coronaviruses in China.” “suggest that global changes”: Gibb et al., “Zoonotic Host Diversity Increases in Human-Dominated Ecosystems.” “conservation of protected”: Intergovernmental Science-Policy Platform on
…
analysis.” in Massachusetts in 2020: Commonwealth of Massachusetts. “Weekly COVID-19 Public Health Report.” Close living quarters: “More Than One-Third of U.S. Coronavirus Deaths Are Linked to Nursing Homes,” The New York Times. Health-related choices: American Medical Association, Issue Brief: Reports of Increases in Opioid- and Other
…
is $55,000: “NYC-Queens Community District 3—Jackson Heights & North Corona PUMA, NY,” Census Reporter. seeded the disease: Bengali, Linthicum, and Kim, “How Coronavirus—a ‘Rich Man’s Disease’—Infected the Poor.” With contagious disease: Beachum, “New York’s ‘Patient Zero’ Breaks His Silence after Surviving Covid-19.” Like
…
Payer and Health Condition, 1996–2016.” CHAPTER 5: WHY DID SO MUCH HEALTH-CARE SPENDING PRODUCE SO LITTLE HEALTH? over $3 trillion annually: Johns Hopkins Coronavirus Resource Center, “Mortality Analyses”; Organisation for Economic Co-operation and Development, “Health Spending.” city of Lubbock: “City of Lubbock Reports 9 Additional COVID-19
…
Reducing Cardiac Events.” companies that wanted to earn: Finkelstein, “The Aggregate Effects of Health Insurance: Evidence from the Introduction of Medicare.” “signed deals”: Gallagher, “Coronavirus Vaccine: UK Government Signs Deals for 90 Million Doses.” deliverable in December: “Pfizer and BioNTech Announce an Agreement with U.S. Government for up to
…
Public Health.” budget of nearly $14 billion: McCluskey, “Partners HealthCare Generates $14 Billion in Revenue.” that works in Haiti and Lesotho: Wallace-Wells, “Can Coronavirus Contact Tracing Survive Reopening?” While US medical spending: Weber et al., “Hollowed-Out Public Health System Faces More Cuts amid Virus.” outspends the US: Source
…
Louis Pasteur: “Louis Pasteur,” Encyclopædia Britannica Online. exclusively on medical insurance: Lubrano, “The World Has Suffered through Other Deadly Pandemics. But the Response to Coronavirus Is Unprecedented.” mostly contained to Asia: World Health Organization Global Influenza Program Surveillance Network, “Evolution of H5N1 Avian Influenza Viruses in Asia.” The Obama administration
…
Science and Technology Council, Towards Epidemic Prediction: Federal Efforts and Opportunities in Outbreak Modeling. a church service: Sang-hun, “Shadowy Church Is at Center of Coronavirus Outbreak in South Korea.” South Korea moved immediately: Thompson, “What’s Behind South Korea’s COVID-19 Exceptionalism? the population of Daegu: Martin and
…
19 Pandemic.” The East Asian countries: LeDuc and Barry, “SARS, the First Pandemic of the 21st Century.” Soldiers’ Home: Hamm, “Holyoke, Chelsea Soldiers’ Homes Receive Coronavirus Vaccine.” The home serves: Commonwealth of Massachusetts, “Soldiers’ Home in Holyoke.” not adequately trained: Jorgenson, “Holyoke Soldiers’ Home, Site of Deadly Outbreak, Dealt with
…
GardaWorld. New Zealand’s Parliament: New Zealand Government, “Managed Isolation and Quarantine”; “Focusing On Preservatives: How They Keep Food Fresh,” ScienceDaily. The country did things: “Coronavirus: How New Zealand Relied on Science and Empathy,” BBC News. The number of new cases: New Zealand Government, Ministry of Health, “COVID-19: Current Cases
…
et al., “The China Syndrome: The Impact of the SARS Epidemic in Southeast Asia.” vice president of Taiwan: Hernández and Horton, “Taiwan’s Weapon against Coronavirus: An Epidemiologist as Vice President.” Singapore also underperformed: Sim, “From Sars to Covid-19, What Lessons Has Singapore Learned?” Germany and the Canadian province:
…
Table A-14. Unemployed Persons by Industry and Class of Worker, Not Seasonally Adjusted.” sales by Woolworth: Velde, 9. Spending on basic needs: Karlamangla, “With Coronavirus Spreading in L.A. County Supermarkets, Here Are Some Tips for Shopping Safely.” In 1910, only 14 percent: Leon. Stanley Jevons: Jevons, The Coal Question
…
, “Regulation and Mobility in Brazil.” “Florida’s done better”: “Donald Trump Ron DeSantis Press Conference Transcript,” Rev. Ardern and Bloomfield did: Cheng, “Covid 19 Coronavirus: Prime Minister Jacinda Ardern’s D-Day Decision Already Made for Her.” Visits to sit-down restaurants: Glaeser et al., “Learning from Deregulation.” 100,000
…
two days: Moderna, “Moderna’s Work on Our COVID-19 Vaccine Candidate.” During the eight months: World Health Organization, “United States of America: WHO Coronavirus Disease (COVID-19) Dashboard.” 2 percent of total: Himmelstein and Woolhandler, “Public Health’s Falling Share of US Health Spending.” rose considerably: US Centers for
…
gov/library/public-papers/68/address-jefferson-day-dinner. Adhikari, Samrachana, Nicholas P. Pantaleo, and Justin M. Feldman. “Assessment of Community-Level Disparities in Coronavirus Disease 2019 (COVID-19) Infections and Deaths in Large US Metropolitan Areas.” JAMA Network Open, July 28, 2020. https://doi.org/doi:10.1001/jamanetworkopen
…
Soldiers’ Home Superintendent Bennett Walsh, Medical Director David Clinton Arraigned on Charges Linked to COVID-19 Outbreak.” MassLive, November 5, 2020. www.masslive.com/coronavirus/2020/11/former-holyoke-soldiers-home-superintendent-bennett-walsh-medical-director-david-clinton-arraigned-on-charges-linked-to-covid-19-outbreak.html. ———. “Independent Report on
…
Zero’ Breaks His Silence after Surviving Covid-19.” The Washington Post, May 11, 2020. www.washingtonpost.com/nation/2020/05/11/patient-zero-new-york-coronavirus. Beautiful Highlands of Los Angeles, Comprising Boyle Heights, Brooklyn Heights, Euclid Heights. Los Angeles, 1900. http://archive.org/details/beautifulhighlan00losa. Becerra, Hector. “The Fast
…
a Heavy Price during the Pandemic.” The Washington Post, May 17, 2020. www.washingtonpost.com/local/trafficandcommuting/transit-workers-are-paying-heavy-price-in-the-coronavirus-pandemic/2020/05/17/d7251b18-8edc-11ea-a9c0-73b93422d691_story.html. “George Stephenson.” Encyclopædia Britannica Online. Accessed January 18, 2021. www.britannica.com/biography
…
Hui, Sylvia. “UK Ramps Up Vaccine Rollout, Targets Every Adult by Autumn.” Associated Press, January 10, 2021. https://apnews.com/article/international-news-england-coronavirus-pandemic-coronavirus-vaccine-ca01f408423b049a7625c6f431acdd8d. Hum, Tarry. “Mapping Global Production in New York City’s Garment Industry: The Role of Sunset Park, Brooklyn’s Immigrant Economy.” Economic Development
…
Britannica Online. Accessed January 18, 2021. www.britannica.com/topic/New-York-Stock-Exchange. “New Zealand.” Worldometer. Accessed December 26, 2020. www.worldometers.info/coronavirus/country/new-zealand. “New Zealand Election: Jacinda Ardern’s Labour Party Scores Landslide Win.” BBC News, October 17, 2020. www.bbc.com/news/world-asia
…
Britannica Online. Last modified January 13, 2021. www.britannica.com/biography/Florence-Nightingale. Selig, David, and Christina Vazquez. “Miami-Dade Closing Indoor Dining amid Coronavirus Spike; Gyms Can Now Stay Open.” Local 10 News, July 6, 2020. www.local10.com/news/local/2020/07/06/miami-dade-closing-restaurants-amid
…
popclock. US Centers for Disease Control and Prevention. “About Variants of the Virus That Causes COVID-19.” Last modified February 12, 2021. www.cdc.gov/coronavirus/2019-ncov/transmission/variant.html. ———. Advancing the Global Health Security Agenda: CDC Achievements and Impact—2018. Washington, DC: Centers for Disease Control and Prevention,
…
Last modified November 3, 2020. www.cdc.gov/hiv/basics/hiv-transmission/substance-use.html. ———. “Hospitalization Rates and Characteristics of Patients Hospitalized with Laboratory -Confirmed Coronavirus Disease 2019—COVID-NET, 14 States, March 1–30, 2020.” April 17, 2020. www.cdc.gov/mmwr/volumes/69/wr/mm6915e3.htm. ———. “How Antibiotic
…
. www.cdc.gov/media/releases/2020/p1218-overdose-deaths-covid-19.html. ———. “People with Certain Medical Conditions.” Last modified February 22, 2021. www.cdc.gov/coronavirus/2019-ncov/need-extra-precautions/people-with-medical-conditions.html. ———. “Plague FAQ.” November 26, 2019. www.cdc.gov/plague/faq/index.html. ———. “Preventing, Detecting
…
/2018/prevent-detect-respond.html. ———. “Risk for COVID-19 Infection, Hospitalization, and Death by Race/Ethnicity.” Last modified February 18, 2021. www.cdc.gov/coronavirus/2019-ncov/covid-data/investigations-discovery/hospitalization-death-by-race-ethnicity.html. ———. “Safer and Healthier Foods.” Morbidity and Mortality Weekly Report 48, no. 40 (October
…
. ———. “Smoking and COVID-19.” Accessed January 20, 2021. www.who.int/news-room/commentaries/detail/smoking-and-covid-19. ———. “United States of America: WHO Coronavirus Disease (COVID-19) Dashboard.” Accessed January 18, 2021. https://covid19.who.int. ———. “Worldwide Burden of Disease from Exposure to Second-Hand Smoke.” February 9, 2011
…
–93 consumer spending, 187 contact tracing, 155, 156, 164, 168 contagion theory of epidemics, 49, 50 Cooper, Peter, 82 cordon sanitaire, 39, 53–54 Coronavirus Aid, Relief, and Economic Security (CARES), 195 corporate relocations, 209 cost of living in urban areas, 235–36 Cothorne, Adell, 311 Council of Chief State
by Scott Gottlieb · 20 Sep 2021
rudimentary surveillance effort. In the absence of surveillance testing, health officials were forced to rely largely on a far less sensitive tool to tell whether coronavirus was starting to spread in local communities: syndromic surveillance. This approach relies on dozens of different streams of information on things such as how
…
in the Morbidity and Mortality Weekly Report, were often thorough, data driven, well researched, and late. The agency issued recommendations on the risk of coronavirus transmission through touching contaminated surfaces (fomites), measures to improve safety in schools, the role of respiratory aerosols and droplets, and countless other aspects of COVID
…
these sorts of countermeasures. In 2015, the head of BARDA, Robin Robinson, told the publication BioCentury that his agency didn’t have funding to develop coronavirus countermeasures. “We are funded for pandemic influenza and man-made threats like anthrax, smallpox, nuclear devices and chemical agents. If we had another emergency
…
drug makers, including Sanofi and Novavax, for their COVID vaccines. By the fall of 2020, nearly seventy different experimental vaccines used segments of the coronavirus spike protein as a way to try to generate immunity. Most used recombinant technology, where the proteins are derived from synthetic genomic material manufactured in
…
Schniming, “Wuhan nCoV Outbreak Quadruples, Spreads within China,” CIDRAP News, January 19, 2020. 3.Walter Sim, “Japan Confirms First Case of Infection from Wuhan Coronavirus; Vietnam Quarantines Two Tourists,” Straits Times, January 17, 2020. 4.World Health Organization (@WHO), “Preliminary Investigations Conducted by the Chinese Authorities Have Found No Clear
…
March 3, 2020. 11.Ibid. 12.Amos Zeeberg, “Piecing Together the Next Pandemic,” New York Times, February 16, 2021; and Ellen C. Carbo et al., “Coronavirus Discovery by Metagenomic Sequencing: A Tool for Pandemic Preparedness,” Journal of Clinical Virology 131, (2020): 104594. 13.Michael T. Osterholm and Mark Olshaker, Deadliest Enemy
…
Muzzled Her for Sharing Report on WeChat,” South China Morning Post, March 11, 2020. 23.Reporters Without Borders, “Whistleblowing Doctor Missing After Criticizing Beijing’s Coronavirus Censorship,” April 14, 2020. 24.Jianxing Tan, “新冠肺炎"吹哨人"李文亮:真相最重要” [“Covid-19 “Whistleblower” Li Wenliang: the Truth is Most Important”], Caixin, January 31, 2020. 25.Lin Zehong,
…
,” January 30, 2020. 50.Heritage Institute, “Virtual Event: One Year Later: Lessons from the Early COVID-19 Response,” January 14, 2021. 51.Cohen, “Mining Coronavirus Genomes for Clues to the Outbreak’s Origins.” 52.World Health Organization, “Pandemic Influenza Preparedness Framework,” May 24, 2011. 53.Emily Baumgaertner, “China Has Withheld
…
Mistakes),” New York Times, January 14, 2021. 68.Nicholas A. Christakis, Apollo’s Arrow (New York: Little, Brown Spark, 2020); and Keng Jin Lee, “Coronavirus Kills Chinese Whistleblower Ophthalmologist,” American Academy of Ophthalmology, February 10, 2020. 69.People’s Daily, “Why Wuhan Central Hospital Has the Highest Rate of Medical
…
Emergency of International Concern,’” April 29, 2009. 72.Xinhua News Agency, “Xi Jinping Made Important Instructions on the Pneumonia Epidemic Caused by the New Coronavirus, Emphasizing That the Safety and Health of the People Should Be Put First, Resolutely Curbing the Spread of the Epidemic, Li Keqiang Issued Instructions,” January
…
for Disease Control and Prevention, “Interim Guidance on Duration of Isolation and Precautions for Adults with COVID-19,” February 13, 2021, https://www.cdc.gov/coronavirus/2019-ncov/hcp/duration-isolation.html. 23.Shatavia S. Morrison, “COVID-19 Genomic Epidemiology Toolkit: Module 1.2,” US Centers for Disease Control and
…
between Analytical Sensitivity and Detection Limit,” American Journal of Clinical Pathology 107, no. 5 (1997): 619. 26.Amy Maxmen, “The Race to Unravel the Biggest Coronavirus Outbreak in the United States,” Nature, March 7, 2020. 27.Fink and Baker, “‘It’s Just Everywhere Already.’” 28.Matt Markovich, “Seattle Flu Study
…
manufactured by Luminex and BioFire. Among the viruses that the BioFire panel can screen for using a single test are Adenovirus, Coronavirus HKU1, Coronavirus NL63, Coronavirus 229E, Coronavirus OC43, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), Human Metapneumovirus, Human Rhinovirus/Enterovirus, Influenza A, Influenza A/H1, Influenza A/H3, Influenza A/H1
…
, Nightmare Scenario: Inside the Trump administration’s Response to the Pandemic That Changed History (New York: HarperCollins, 2021). 17.Brett Murphy and Letitia Stein, “Coronavirus Response Delayed Despite Health Officials’ Private Alarm,” USA Today, January 26, 2021. On February 29, CDC director Robert Redfield said at a White House press
…
Transmitted Pathogen,” Current Opinion in Infectious Diseases 31, no. 1 (2018): 39–44. 21.David William, “Lessons Unlearned: Four Years before the CDC Fumbled Coronavirus Testing, the Agency Made Some of the Same Mistakes with Zika,” Washington Post, July 4, 2020. 22.US Centers for Disease Control and Prevention, “Trioplex
…
, “Response to Investigative Team Explanation.” Chapter 7: The CDC Fails 1.US Food and Drug Administration, “Accelerated Emergency Use Authorization (EUA) Summary ORIG3N 2019 Novel Coronavirus (COVID-19) Test (ORIG3N, INC.),” April 4, 2020, https://www.fda.gov/media/136873/download; and Ruth McBride, Marjorie van Zyl, and Burtram Fielding,
…
reporter, “Integrated DNA Technologies Authorized under CDC EUA to Provide SARS-CoV-2 Test Kits,” Genome Web, March 3, 2020. 18.David Willman, “CDC Coronavirus Test Kits Were Likely Contaminated, Federal Review Confirms,” Washington Post, June 20, 2020. 19.Alexander Borst et al., “False-Positive Results and Contamination in Nucleic
…
of the Immediate Office of the General Counsel’s Investigation Regarding CDC’s Production of COVID-19 Test Kits.” 27.Ibid; and Willman, “CDC Coronavirus Test Kits Were Likely Contaminated, Federal Review Confirms.” 28.The CDC ultimately made the virus available to test manufacturers through BEI Resources, a quasi-governmental
…
Human Services press release, January 31, 2020, https://www.hhs.gov/about/news/2020/01/31/secretary-azar-declares-public-health-emergency-us-2019-novel-coronavirus.html; and US Food and Drug Administration, “Determination of a Public Health Emergency and Declaration that Circumstances Exist Justifying Authorizations Pursuant to Section 564(
…
and Human Services, “Rescission of Guidances and Other Informal Issuances Concerning Premarket Review of Laboratory Developed Tests,” August 19, 2020, https://www.hhs.gov/coronavirus/testing/recission-guidances-informal-issuances-premarket-review-lab-tests/index.html. 34.Kathleen McLaughlin, “HHS Relaxed Oversight of Problematic Covid-19 Tests Despite Being Told
…
2020, https://www.washingtonpost.com/context/letter-from-aphl-to-fda-commissioner-stephen-hahn/547133a7-6e13-4995-b14d-c3e0748e90b8/; and Boburg et al., “Inside the Coronavirus Testing Failure.” 36.Scott Gottlieb (@ScottGottliebMD), “THREAD ON DIAGNOSTICS: In recent public health emergencies there’s been a stepwise approach to ramp up U.S
…
With this data, the state would be able to seek authorization to do their own testing using New York State’s laboratory developed test. 48.“Coronavirus (COVID-19) Update: FDA Provides More Regulatory Relief During Outbreak, Continues to Help Expedite Availability of Diagnostics,” US Food and Drug Administration press release,
…
March 16, 2020, https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-provides-more-regulatory-relief-during-outbreak-continues-help. 49.Caroline Chen, Marshall Allen, and Lexi Churchill, “Internal Emails Show How Chaos
…
-19 should be evaluated among potentially exposed healthcare personnel.” See US Centers for Disease Control and Prevention, “Updated Guidance on Evaluating and Testing Persons for Coronavirus Disease 2019 (COVID-19),” March 8, 2020. 57.The CDC ultimately made the virus available to test manufacturers through BEI Resources. The University of
…
of a virus. See US Food and Drug Administration, “EUA Authorized Serology Test Performance,” accessed February 26, 2021, https://www.fda.gov/medical-devices/coronavirus-disease-2019-covid-19-emergency-use-authorizations-medical-devices/eua-authorized-serology-test-performance. 5.“Abbott’s Fast, $5, 15-Minute, Easy-to-Use COVID
…
Skilled Nursing News, July 31, 2020. 19.Ritter and Metz, “Nevada Reverses Ban on Rapid Tests after Federal Pushback.” 20.US Food and Drug Administration, “Coronavirus (COVID-19) Update: FDA Takes Steps to Streamline Path for COVID-19 Screening Tools, Provides Information to Help Groups Establishing Testing Programs,” March 16, 2021
…
, https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-takes-steps-streamline-path-covid-19-screening-tools-provides. 21.“Trump Interrupts Health Officials: ‘Anybody That Wants a Test Can Get
…
Update: White House Press Briefing by FDA Commissioner Stephen M. Hahn, M.D.,” March 7, 2020, https://www.fda.gov/news-events/speeches-fda-officials/coronavirus-covid-19-update-white-house-press-briefing-fda-commissioner-stephen-m-hahn-md-03072020. 24.COVID-19 Test Capacity (@COVID2019tests), Twitter, https://twitter.com/COVID2019tests
…
-statewide-shutdown-restaurants-bars-and-limits-size-gatherings-expanded. 31.Weizhen Tan and Riya Bhattacharjee, “California Governor Issues Statewide Order to ‘Stay at Home’ as Coronavirus Cases Soar,” CNBC, March 20, 2020. Chapter 9: Shortage after Shortage 1.WECT Staff, “CDC Recommends Healthcare Providers Assume Those with Mild Symptoms to
…
/news/governors-of-six-states-announce-major-bipartisan-compact-for-three-million-rapid-antigen-tests/. 39.Erin Cox, “There’s No National Testing Strategy for Coronavirus. These States Banded Together to Make One.,” Washington Post, August 4, 2020. 40.Scott Gottlieb, “The States Are Laboratories for Covid Control,” Wall Street
…
Social Activity in Virus Fight, Warns of Recession,” Reuters, March 16, 2020. 15.Benjamin Siegel, “How Anesthesia Machines Can Help Hospitals with Ventilator Shortages Fight Coronavirus,” ABC News, March 27, 2020; and Kathleen Moore, “Local Anesthesiologists Converting Machines to Ventilators,” Post Star, March 26, 2020. 16.Jessie Yeung et al.,
…
on smallpox eradication would never have started—selecting the target helped develop the appropriate tools and strategy.” 21.Amanda Watts, “Health Official’s Advice on Coronavirus Response: ‘Speed Trumps Perfection,’” CNN, March 13, 2020. 22.James Glanz and Campbell Robertson, “Lockdown Delays Cost at Least 36,000 Lives, Data Show,”
…
/questions-answers/questions-answers-prevention. 41.Alvin Powell, “Is Air Conditioning Helping Spread COVID in the South?,” Harvard Gazette, June 29, 2020; Christopher Flavelle, “Coronavirus Makes Cooling Centers Risky, Just as Scorching Weather Hits,” New York Times, May 6, 2020; and Jianyun Lu et al., “COVID-19 Outbreak Associated with
…
for Disease Control and Prevention, “Discontinuation of Isolation for Persons with COVID-19 Not in Healthcare Settings,” February 18, 2021, https://www.cdc.gov/coronavirus/2019-ncov/hcp/disposition-in-home-patients.html. 8.Julia C. Pringle et al., “COVID-19 in a Correctional Facility Employee Following Multiple Brief Exposures
…
Situational Awareness Network Capabilities,” September 2017; and Yuval Levin, “Biden’s Pandemic-Policy Challenge,” National Review, January 18, 2021. 32.Melissa Healy, “California’s Coronavirus Strain Looks Increasingly Dangerous: ‘The Devil Is Already Here,’” Los Angeles Times, February 23, 2021. 33.Public Health England, “SARS-CoV-2 Variants of Concern
…
and Epidemiology of Middle East Respiratory Syndrome Corona Virus,” Multidisciplinary Respiratory Medicine 12, no. 20 (2017). 5.World Health Organization, “Middle East Respiratory Syndrome Coronavirus (MERS-CoV)—Saudi Arabia,” December 4, 2015, https://www.who.int/csr/don/4-december-2015-mers-saudi-arabia/en/. 6.Al-Osail and Al
…
Light on Chaotic COVID Decision-Making during Trump Administration,” Biocentury, May 14, 2021. 29.Tina Nguyen, “How a Chance Twitter Thread Launched Trump’s Favorite Coronavirus Drug,” Politico, April 7, 2020. 30.Kevin Roose and Matthew Rosenberg, “Touting Virus Cure, ‘Simple Country Doctor’ Becomes a Right-Wing Star,” New
…
Bloomberg, April 20, 2020. 26.Stacy Lawrence, “Regeneron, BARDA Partner to Develop MERS Virus Treatment,” Fierce Biotech, August 22, 2016; and “Antibody Treatment for MERS Coronavirus Safe in People,” US National Institutes of Health press release, March 2, 2021. 27.George D. Yancopoulos, cofounder, president, and chief scientific officer of Regeneron
…
Gottlieb and Mark McClellan, “The Trump Treatment for Covid Is Coming Soon,” Wall Street Journal, October 8, 2020. 35.CBS News, “Transcript: Scott Gottlieb Discusses Coronavirus on ‘Face the Nation,’ October 11, 2020,” October 11, 2020. 36.Scott Gottlieb, “Antibodies as Covid Insurance,” Wall Street Journal, December 13, 2020. 37
…
and New Vaccine Variants,” Pfizer press release, February 25, 2021. 39.Kevin O. Saunders et al., “Neutralizing Antibody Vaccine for Pandemic and Pre-emergent Coronaviruses,” Nature (2021). Chapter 18: A New Doctrine for National Security 1.“There is no recent precedent for treating disease as a security threat. So unfamiliar
…
Cases,” Clinical Infectious Diseases 42, no. 5 (2006): 634–9. 9.Patrick C. Y. Woo et al., “Characterization and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia,” Journal of Virology 79, no. 2 (2004): 884–95. 10.Xinhua, “21 Doctors, Nurses Infected with Pneumonia in E
…
investigators needed to safely operate this high-containment laboratory.” See Josh Rogin, “Opinion: State Department Cables Warned of Safety Issues at Wuhan Lab Studying Bat Coronaviruses,” Washington Post, April 14, 2020. 46.US Department of State, “Fact Sheet: Activity at the Wuhan Institute of Virology.” 47.Bryan A. Johnson, Xuping
…
Uncover COVID-19’s Origins.” 60.US National Institutes of Allergy and Infectious Diseases of the National Institutes of Health, “Understanding the Risk of Bat Coronavirus Emergence,” 2014–19, https://reporter.nih.gov/search/xQW6UJmWfUuOV01ntGvLwQ/project-details/9491676; and Peter Daszak and Vincent Racaniello, “This Week in Virology 615: Peter
…
173 National Academy of Medicine, 386–87 National Academy of Science’s Institute of Medicine, 342–43 National Aeronautics and Space Administration (NASA), 8 “National Coronavirus Response: A Road Map to Reopening” (AEI report), 250–52 National Human Genome Research Institute, 373 National Institute of Allergy and Infectious Diseases (NIAID),
by Gregory Zuckerman · 25 Oct 2021 · 368pp · 106,185 words
revolutionary, helped found Moderna Jason Mclellan—Structural biologist, discovered way to keep spike protein in ideal form Nianshuang Wang—Native of China, worked on breakthrough coronavirus research Government Scientists Anthony Fauci—Top U.S. infectious-disease expert Barney Graham—Deputy director, Vaccine Research Center; chased RSV vaccines, worked with Moderna on
…
, he’d use his insect system to try to develop other vaccines. Eventually, he’d focus on a very different kind of pathogen: a new coronavirus. 3 1996–2008 Mice lie, monkeys mislead, and ferrets are weasels. —a popular aphorism among scientists The phone rang in John Shiver’s office,
…
a vaccine technology to defend against malaria, influenza, and many other viruses and diseases. Eventually, they’d even use it to take on a novel coronavirus. * * * • • • Dan Barouch was sure he could avoid Merck’s mistake. Barouch was a thirty-one-year-old scientist in 2004, running a small research
…
lowest point,” says McLellan. McLellan called Graham for advice. In his soothing tone, Graham suggested that McLellan focus on a different type of pathogen: coronaviruses. These viruses didn’t usually grab the attention of the public, nor did most scientists care too much about them, but they are ancestrally related
…
responsible for little more than cause the common cold. Specialists in the field didn’t mind that no one cared about the area. To them, coronaviruses were unusual and interesting pathogens that expressed their genes and proteins in unique ways, satisfying the researchers’ intellectual curiosity. For some, the relative obscurity of
…
memorable for the socializing and delicious food and wine served as for the captivating presentations delivered. By then, a view had emerged that the human coronavirus, called OC43, likely arose in the nineteenth century, perhaps jumping from cows to humans before melting into civilization’s background as one of the causes
…
pathogens and for saying that colds need to run their course. But I reply with frank chagrin “Why must the blasted thing BEGIN?”8 Eventually, coronavirus vaccines were introduced for some livestock, protecting their vulnerable respiratory and gastrointestinal systems from the virus, but most scoffed at the notion of focusing precious
…
disease it caused was called SARS, short for severe acute respiratory syndrome. Soon it was killing people, reaching a mortality rate of 10 percent. Coronavirus-obsessives were absolutely stunned. They had no idea that a version of the pathogen they were so passionate about could kill humans. Suddenly, their field
…
Soon a global health crisis was under way, as the virus causing the disease, MERS-CoV, spread to dozens of countries, sparking renewed interest in coronaviruses that eventually helped McLellan receive the funding he needed for his growing Dartmouth lab. McLellan and Graham began focusing on a vaccine for MERS, helped
…
competing academic groups to the finish line, his first huge scientific achievement. Wang, who had a full face and spikey dark hair, was convinced coronaviruses would continue to threaten global health, and he was disturbed by how little was known about them. After reading about McLellan’s RSV breakthrough, he
…
and others in Graham and Ward’s labs, Wang had submitted a paper detailing their MERS research, demonstrating a potentially universal method of stabilizing the coronavirus’s spike protein to enable an effective vaccine, but the paper had been rejected by all five of the leading scientific journals. One reviewer called
…
group’s paper eventually was accepted for publication by a respected, though second-tier, journal, but most scientists ignored the research, many still uninterested in coronaviruses, a reaction that left Wang further dejected. “People will find it,” McLellan told him, trying to cheer him up. At night, Wang found it
…
while Moderna would produce the mRNA molecules, wrapping them with Benenato’s new lipids. The two partners immediately produced a vaccine for MERS-CoV, the coronavirus that was causing MERS. Their shots generated impressive levels of antibodies in tests on mice and monkeys, but before testing on humans could proceed, the
…
epidemic died out. Nevertheless, the two teams were pretty sure their shots would have proven effective, and maybe would have been enough to halt that coronavirus. They vowed to team up, once again, if a similar virus ever emerged. * * * • • • Bancel was convinced his company was making progress. Outsiders were dubious.
…
Almost simultaneously, they reached the same conclusion. “It’s SARS, it’s SARS!” Zhang said. Shit, it’s back, Holmes thought, referring to another pernicious coronavirus. Zhang and his colleagues in China began cautioning authorities in the country. After sending a warning to the NHC, Zhang boarded a flight to Wuhan
…
Davos, Switzerland, to join thousands of global leaders at the annual meeting of the World Economic Forum, he was becoming more concerned about the novel coronavirus. At the event, attendees debated economic, political, and environmental topics, and Bancel spent some time trying to understand why investors were so discouraged about
…
-19 vaccines, called mRNA-1273, to Corbett, the NIH scientist, to begin testing in mice. Within weeks, early results showed it elicited antibodies to the coronavirus, a promising, albeit early, sign. Moderna staffers were accustomed to self-confidence, even boasts, from Bancel. When he met with Fauci and the others,
…
catch Garbuz if he fell. It was more important to allay the public’s concerns than to face the new reality. * * * • • • As the new coronavirus spread, it seemed similar to most other respiratory illnesses, at least at first. Patients suffered from fever, coughs, and shortness of breath. Soon, though, it
…
became clear this one was uniquely treacherous. The novel coronavirus could affect the kidneys, heart, and liver, and the circulatory and gastrointestinal systems. Sometimes patients’ lungs filled with so much fluid they weren’t able
…
Viral particles traveled to the backs of nasal passages and to mucous membranes in the throat. Soon the virus was spreading all over the body. Coronavirus particles, with their trademark spiked proteins protruding from their spherical surfaces, hooked on to the cell membranes, enabling the virus’s genetic material to enter
…
help people to avoid the virus. Scientists began employing techniques they had developed to fight previous viruses and diseases, including AIDS, to slow the new coronavirus. It had taken years, but by early 2020, researchers at companies like Gilead Sciences, outside San Mateo, California, had introduced cocktails of antiretroviral pills
…
In early 2020, Eli Lilly and Regeneron Pharmaceuticals began producing these kinds of drugs, called monoclonal antibodies, to help some patients dealing with the new coronavirus. A cheap steroid called dexamethasone also proved capable of decreasing mortality, providing doctors with still another way to fend off Covid-19. It soon became
…
of those nations’ vaccines might not be reliable. Instead, they pinned their hopes on Western vaccine powers, such as Merck. * * * • • • As news of the new coronavirus emerged, Merck’s executives gathered at the company’s West Point, Pennsylvania, research and manufacturing site and elsewhere, debating whether to participate in what they
…
email Johan Van Hoof, the head of global vaccines at Johnson & Johnson’s Janssen Pharmaceuticals division, his partner on the HIV and Zika vaccines. “The coronavirus outbreak in China is looking bad,” Barouch wrote. “Human-to-human transmission appears quite efficient, including from asymptomatic individuals without fevers, which may make epidemic
…
was urging his company to go full speed ahead. “I had the zeal of the converted,” he says. Some of the Pfizer executives were witnessing coronavirus’s impact firsthand. Jansen and some others continued coming into the company’s Midtown Manhattan office, sometimes passing refrigerated trucks that stored victims who had
…
work. “Treatments save lives,” Schuitemaker liked to tell colleagues in Crucell’s offices in the Dutch city of Leiden. “But vaccines save populations.” When the coronavirus crisis worsened in the early spring, however, some senior J&J executives were having second thoughts about Schuitemaker’s idea of using high-potency shots
…
&J knew they might not have the first vaccine, but their shots had a chance to be the most protective and convenient. * * * • • • As the coronavirus spread, thousands of scientists around the world raced to build vaccines capable of protecting people from what increasingly seemed like a modern-day new plague
…
Failure would also likely mean other vaccine efforts were doomed, since so many shared common elements with Pfizer/BioNTech’s approach, such as targeting the coronavirus’s spike protein. Some at Pfizer had intensely personal reasons to explain why they were praying for good news. Philip Dormitzer, who along with Jansen
…
percent effective at preventing symptomatic disease in adults, more proof that Smith and his colleagues had developed one of the most effective vaccines against the coronavirus. Regulatory clearances were still months away because the company had yet to ensure that its manufacturing processes met regulatory standards. The delays meant it was
…
could relax a bit after their difficult year and eventual vaccine success. They never had a chance. As new and dangerous variant strains of the coronavirus emerged during 2021, Bancel and his colleagues scrambled to rework their vaccine, develop potential booster shots to handle new variants, and test vaccines for adolescents
…
the BioNTech scientists were even eyeing challenging diseases like tuberculosis and AIDS. His ambitions raised the tantalizing prospect that the horrors wrought by the deadly coronavirus could, in an indirect way, help vanquish some of the cruelest diseases known to humankind. Still biking to work, Şahin continued to leave colleagues
…
617.2, or the Delta variant, emerged. The variant, which swept through India before sparking waves of infection elsewhere, served as a reminder that the coronavirus wasn’t nearly finished terrorizing the world. For most people, Covid-19 vaccines provided sufficient protection from the most dangerous effects of the variant. But
…
virus that leads to seasonal disease, like influenza, as well as more painful, periodic outbreaks. Humankind will likely need to learn to live with the coronavirus, while finding creative ways to encourage unvaccinated populations to roll up their sleeves and receive shots. But if the virus is discovering creative ways to
…
out. And researchers at Walter Reed are testing a supershot that might confer immunity against a wide variety of pathogens, including new strains of the coronavirus. The researchers believe their shots will trigger such a strong immune response that they will potentially fend off many types of viruses and diseases. “
…
viruses were also discovered in central African monkeys and apes, thus ending the debate. It may take even longer to discover the origins of the coronavirus in nature. “Virologists need time,” Wain-Hobson says. * * * • • • Crises and catastrophes often result in medical breakthroughs. Ambulances and anesthesia emerged from World War I,
…
applied to civilian patients. “Society usually makes progress out of necessity,” argues Jeremy Farrar, director of the Wellcome Trust. Good has already resulted from the coronavirus crisis. Many people adopted healthier balances between their professional and personal lives and a new appreciation for family. Hopefully, these shifts will be long-lasting
…
During the worst of the 2020 crisis, Anthony Fauci received death threats and some politicians suggested that doctors were inflating the death toll from the coronavirus as a means of generating higher hospital fees. The counsel and guidance of public health authorities likely will be needed again, perhaps soon. There’
…
2020, Rabbi Lord Jonathan Sacks noted that the United States and the United Kingdom, two of the countries that had suffered the most from the coronavirus crisis, are also the nations best known for defending liberty and freedom, while prizing, even venerating, individualism. Working at The Wall Street Journal during
…
effort were likely motivated, at least in part, by fame and fortune, suggesting that promoting individual goals can bring broader benefits. Better, though, that the coronavirus crisis results in a renewed emphasis on collective relationships and an appreciation for those who make sacrifices on behalf ofothers. “I think future anthropologists will
…
Chemical & Engineering News, September 29, 2020, https://cen.acs.org/pharmaceuticals/vaccines/tiny-tweak-behind-COVID-19/98/i38. 6. Elisabeth Mahase, “Covid-19: First Coronavirus Was Described in the BMJ in 1965,” British Medical Journal 369, no. 8242 (April 2020): m1547, https://doi.org/10.1136/bmj.m1547. 7. Ivan
…
Oransky, “David Tyrrell,” Lancet 365, no. 9477 (June 2005): 2084, https://doi.org/10.1016/S0140-6736(05)66722-0; Mahase, “Covid-19: First Coronavirus.” 8. Oransky, “David Tyrrell.” 9. Yanzhong Huang, “The SARS Epidemic and Its Aftermath in China: A Political Perspective,” in Learning from SARS: Preparing for the
…
the First COVID-19 Genome Speaks Out About the Controversies Surrounding His Work,” Time, August 24, 2020, https://time.com/5882918/zhang-yongzhen-interview-china-coronavirus-genome. 10. Natasha Khan, “New Virus Discovered by Chinese Scientists Investigating Pneumonia Outbreak,” Wall Street Journal, January 8, 2020, https://www.wsj.com/articles/
…
Report—How a British COVID-19 Vaccine Went from Pole Position to Troubled Start,” Reuters, December 24, 2020, https://www.reuters.com/article/us-health-coronavirus-britain-vaccine-sp-idUKKBN28Y0XU. 5. Baker, “Covid Vaccine Front-Runner.” 6. Sarah Gilbert, “If This Doesn’t Work, I’m Not Sure Anything Will,”
…
“Trump Seeks Push to Speed Vaccine, Despite Safety Concerns,” New York Times, April 29, 2020, https://www.nytimes.com/2020/04/29/us/politics/trump-coronavirus-vaccine-operation-warp-speed.html. 8. Helen Branswell, “Vaccine Experts Say Moderna Didn’t Produce Data Critical to Assessing Covid-19 Vaccine,” STAT News, May
…
, “Decades of Work, and Half a Dose of Fortune, Drove Oxford Vaccine Success,” Reuters, November 23, 2020, https://www.reuters.com/article/us-health-coronavirus-astrazeneca-oxford/decades-of-work-and-half-a-dose-of-fortune-drove-oxford-vaccine-success-idUKKBN2832NC?edition-redirect=uk. 7. Clive Cookson et al., “How
by Debora MacKenzie · 13 Jul 2020 · 266pp · 80,273 words
case turned up in Thailand. “Sticking my neck out to the chopping block, I suspect there may already be significant ongoing transmission of this novel coronavirus,” Pollack wrote on ProMED. However, most cases were not being reported, because they were mild and unrecognized. About that, she wrote, “I obviously hope
…
was nothing like SARS. “Clinical presentations greatly resemble SARS-CoV. The number of deaths is rising quickly,” they wrote. “We are concerned that the novel coronavirus could have acquired the ability for efficient human transmission”—in other words, better than the clumsy SARS virus. Scientists are good at understatement, but that
…
tracing, to break all the chains of transmission before there were many cases. In fact, those were tools China already had. In 2003, the SARS coronavirus initially spread out of control in China, and eventually in countries around the world, because doctors’ initial warnings about the outbreak were stifled, at first
…
privacy experts have valid concerns about the expanded electronic surveillance involved. But the virus was contained. You didn’t need a history of tangling with coronaviruses to do the right thing, though. The small Italian town of Vò in Lombardy kept the virus under control by testing everyone and then imposing
…
panel of scientists made the original selection. To be fair, though, they didn’t completely fail to predict this pandemic: the first list did include “coronaviruses.” We knew the risk. Most of the priority pathogens, however, are not previously unknown viruses lurking in wildlife in a hotspot. All but one were
…
Chinese scientists were already warning that the virus could well lurk in other species. Also that year, virologists at the Wuhan Institute of Virology reported coronaviruses that were very similar to SARS in bats, which were also sold at markets. “If no action is taken to control wildlife markets,” Zhong Nanshan
…
a conservation as well as disease-hunting organization, says Olival, “we don’t want to harm the bats.” The samples from Yunnan are analyzed for coronaviruses, but PREDICT has operations like this looking at different kinds of high-risk wildlife, and different pathogens, in Bangladesh, Brazil, Colombia, Indonesia, Malaysia, and
…
and human cells. It was also instantly recognized by antibodies, immune proteins that are highly specific for particular pathogens, from SARS patients in 2003. “Bat coronaviruses remain a substantial global threat to public health,” Shi’s team concluded. In 2017, the team reported more SARS-like viruses from the bats and
…
an increased probability that this will occur in China,” Shi wrote in a review of the research just last year. “Therefore, the investigation of bat coronaviruses becomes an urgent issue for the detection of early warning signs.” Every disaster movie starts with someone ignoring a scientist. It is now too late
…
Chinese scientists, most in Wuhan, and the new disease was raging in their town. They recapped the work to date: they had discovered SARS-like coronaviruses in their natural reservoir, bats. “Previous studies have indicated that some of those bat SARS-CoVs have the potential to infect humans,” they recalled. The
…
good “for vision, especially at night.” (In fact, bats have excellent vision for the same reason birds do: they fly.) Sampling in Yunnan found bat coronaviruses in fresh horseshoe bat feces. Drying fresh bat droppings collected in the wild might kill viruses in it, but possibly not always completely, especially if
…
though? The aim of the WHO’s R&D roadmap is to develop vaccines, treatments, and diagnostics for its list of priority pathogens, which includes coronaviruses in general. In theory, we could have done that. In practice, until one of these viruses causes extensive disease in people, much expenditure is unlikely
…
Sampath, chief scientist at FIND, a non-profit in Geneva that promotes diagnostics development, it can tell whether it is a hitherto unknown flu, or coronavirus, or a member of other virus families. It was initially sponsored by DARPA, the US defense research agency that (DARPA people always mention) invented the
…
wants surveillance extended to respiratory RNA viruses other than flu, with sampling from around the world, especially in suspected hotspots. They want it to include coronaviruses, Nipah and Hendra viruses, and enteroviruses, the most common family of viral infections in humans, which are mostly symptomless or mild—except a few,
…
if so what mutations to watch for. The US National Institute of Allergy and Infectious Diseases decided last year to renew funding for studies of coronaviruses at the Wuhan Institute of Virology for just that reason. The dilemma is always that doing the experiments without very tight containment might create the
…
theories suggesting Covid-19 does not have a natural origin,” it said. Scientists from many countries had studied it, “and they overwhelmingly conclude that this coronavirus originated in wildlife.” Calling the efforts of China’s scientific community to deal with the outbreak and share their results “remarkable,” they concluded, “We want
…
even though chikungunya, another mosquito-borne virus from Africa, made exactly the same trip in 2013. When virologists in Wuhan and North Carolina found bat coronaviruses that made mice sick and easily infected human cells in 2013, they practically shouted about the pandemic concerns this raised. Scientists also did that in
…
virus much like Covid-19 in bats and warned of its pandemic potential, but that didn’t nudge research agencies to fund renewed work on coronavirus vaccines. The 2008 market crash—itself a textbook product of complexity and tight coupling in the global financial system—triggered government cuts that tightened health
…
the epidemic grew, thought would happen. Maybe they thought they could keep most cases of the infection safely contained in hospitals. Everyone remembered SARS, another coronavirus, and people with SARS normally didn’t spread the virus until they were quite ill. Secrecy can also become an instinct in authoritarian systems, though
…
were not prepared. Covid-19 was an unnecessary catastrophe: we knew enough to keep people away from bat viruses, to develop drugs and vaccines for coronaviruses, and to set up transparent, truly global surveillance networks for outbreaks of potentially pandemic disease. Such surveillance systems would mean that if an outbreak occurs
…
Susan Rice, petitioned the US government to cooperate with China in fighting Covid-19. “China has much to answer for in its response to the coronavirus: its initial coverup, its continuing lack of transparency,” they wrote. “Notwithstanding this, we the undersigned believe that the logic for cooperation is compelling.” In
…
-mail Archive 20200103.6869668, January 3, 2020. Available at: www.promedmail.org. 7. On January 8th… spread: ProMED-mail, “Undiagnosed pneumonia—China (HU) (05): novel coronavirus identified,” ProMED-mail Archive 20200108.6877694, January 8, 2020. Available at: www.promedmail.org. 8. “critical public… wrong”: Jeremy Farrar, Twitter Post, January 10, 2020
…
, 9:50 AM, twitter.com/JeremyFarrar/status/1215647022893670401. 9. The Shanghai… spawned SARS: Zhuang Pinghui, “Chinese laboratory that first shared coronavirus genome with world ordered to close for ‘rectification,’ hindering its Covid-19 research,” South China Morning Post, February 28, 2020, www.scmp.com/news/china
…
/society/article/3052966/chinese-laboratory-first-shared-coronavirus-genome-world-ordered. 10. On January 7th… the virus: Andrew Rambaut, “Preliminary phylogenetic analysis of 11 nCoV2019 genomes, 2020-01-19,” Virological, virological.org/t
…
/preliminary-phylogenetic-analysis-of-11-ncov2019-genomes-2020-01-19/329. 11. The Shanghai lab… next day: Zhuang Pinghui, “Chinese laboratory that first shared coronavirus genome with world ordered to close for ‘rectification,’ hindering its Covid-19 research.” 12. In January, they… go to the hospital: Natsuko Imai, et
…
al., “Report 1—Estimating the potential total number of novel Coronavirus (2019-nCoV) cases in Wuhan City, China,” MRC Centre for Global Infectious Disease Analysis, January 17, 2020, www.imperial.ac.uk/mrc-global-infectious-disease
…
(January 2020): 514–23, doi.org/10.1016/s0140-6736(20)30154-9. 14. On January 15th… sustained human-to-human transmission: ProMED-mail, “Novel coronavirus (05): China (HU), Japan ex China,” ProMED-mail Archive 20200115.6891515, January 15, 2020. Available at: www.promedmail.org. 15. On January 18th… served:
…
cover-up,” Financial Times, February 6, 2020, www.ft.com/content/fa83463a-4737-11ea-aeb3-955839e06441. 17. Then a local… correct here: ProMED-mail, “Novel coronavirus (07): China (HU), Thailand ex China, Japan ex China, WHO,” ProMED-mail Archive 20200117.6895647, January 17, 2020. Available at: www.promedmail.org. 18.
…
By January 20th… climbing: ProMED-mail, “Novel coronavirus (11): China (HU), South Korea ex China,” ProMED-mail Archive 20200120.6899007, January 20, 2020. Available at: www.promedmail.org. 19. Also on… people: Caixin
…
wuhan-whistle. 28. Back in December… department: Translation by Elisabeth Bik, “Dr. Ai Fen, 艾芬, the Wuhan Whistle.” 29. The news… censored: Kynge, Yu, and Hancock, “Coronavirus: the cost of China’s public health cover-up.” 30. The hospital told… alarm: Translation by Elisabeth Bik, “Dr. Ai Fen, 艾芬, the Wuhan Whistle.” 31
…
. The Japanese… rumors: Keisuke Kawazu, “Public backlash over China gov’t accusations against docs who sounded coronavirus alarm,” The Mainchi, January 31, 2020, mainichi.jp/english/articles/20200131/p2a/00m/0in/021000c. 32. And, that day… YY: Lotus Ruan, Jeffrey Knockel, and
…
Masashi Crete-Nishihata, “Censored contagion: how information on the coronavirus is managed on Chinese social media,” The Citizen Lab (University of Toronto), March 3, 2020, citizenlab.ca/2020/03/censored-contagion-how-information-on-the
…
, “China created a fail-safe system to track contagions. It failed,” New York Times, March 29, 2020, www.nytimes.com/2020/03/29/world/asia/coronavirus-china.html. 36. more people… down stairs: Phil Hammond, Twitter Post, January 24, 2020, 3:10 AM, twitter.com/drphilhammond/status/1220619993408266241. 37. Using…
…
case infected: Matt J Keeling, et al., “The efficacy of contact tracing for the containment of the 2019 novel coronavirus (COVID-19),” medRxiv preprint, February 17, 2020, doi.org/10.1101/2020.02.14.20023036. 38. Rosalind… symptoms: Joel Hellewell, et al., “Feasibility of
…
2020, www.facebook.com/watch/?v=1284271178628870. 41. At the end… nearly half: Benjamin J. Cowling, et al., “Impact Assessment of Non-Pharmaceutical Interventions against Coronavirus Disease 2019 and Influenza in Hong Kong: an Observational Study,” The Lancet Public Health 5, no. 5 (April 2020), doi.org/10.1016/s2468-2667
…
0447, February 20, 2003. Available at: www.promedmail.org. 6. Both viruses… inflammation: Meredith Wadman, Jennifer Couzin-Frankel, Jocelyn Kaiser, and Catherine Matacic, “How does coronavirus kill? Clinicians trace a ferocious rampage through the body, from brain to toes,” Science, April 17, 2020, www.sciencemag.org/news/2020/04/how-does
…
. If no action… strain: Nanshan Zhong and Guangqiao Zeng, “What we have learnt from SARS epidemics in China.” 16. he discovered… ProMED: ProMED-mail, “Novel coronavirus—Saudi Arabia: human isolate,” ProMED-mail Archive 20120920.1302733, September 20, 2012. Available at: www.promedmail.org. 17. Within days… Jeddah: Debora MacKenzie, “Threatwatch:
…
bird-flu-research-findings. 19. There was… February 2020: Cissy Zhou, “China reports outbreak of deadly bird flu among chickens in Hunan province, close to coronavirus epicentre of Wuhan,” South China Morning Post, February 2, 2020, www.scmp.com/news/china/society/article/3048566/china-reports-outbreak-deadly-bird-flu-among
…
.gov/grants/guide/notice-files/NOT-OD-17-071.html. 26. In 2019, NIAID… human cells: Peter Daszak (EcoHealth Alliance), “Understanding the risk of bat coronavirus emergence,” Project Number: 2R01AI110964-06, NIH Research Portfolio Online Reporting Tools (RePORT), projectreporter.nih.gov/project_info_description.cfm?aid=9819304&icde=49645421. 27. EcoHealth
…
org/10.1016/j.vaccine.2016.08.019. 26. Bill Gates… discarded: Isobel Asher Hamilton, “Bill Gates is helping fund new factories for 7 potential coronavirus vaccines, even though it will waste billions of dollars,” Business Insider, April 3, 2020, www.businessinsider.com/bill-gates-factories-7-different-vaccines-to-fight
…
stockpile-he-built-1269954. 34. Guaranteeing that right… standard: International Labour Organization (UN), COVID-19 and the world of work,” www.ilo.org/global/topics/coronavirus/impacts-and-responses/WCMS_739049/lang--en/index.htm 35. The GPMB… $53 billion: Caroline Huber, et al., “The economic and social burden of the
…
The Journal of Infectious Diseases 218, supplement 5 (October 2018), doi.org/10.1093/infdis/jiy213. 36. cancer deaths… hospitals: Denis Campbell and Caroline Bannock, “Coronavirus crisis could lead to 18,000 more cancer deaths, experts warn,” Guardian, April 28, 2020, www.theguardian.com/society/2020/apr/29/extra-18000-cancer
…
-ordination let virus spread—UN’s Guterres,” Television newscast, Interview by Nick Bryant, May 1, 2020, www.bbc.com/news/av/world-us-canada-52496983/coronavirus-lack-of-co-ordination-let-virus-spread-un-s-guterres. 24. But that… average incomes: Shannon K. O’Neill, “How to pandemic-proof globalization,”
…
.S. tried to build a new fleet of ventilators. The mission failed,” New York Times, March 29, 2020, www.nytimes.com/2020/03/29/business/coronavirus-us-ventilator-shortage.html. 8. certainly not… valid claim: Kristian Andersen, “nCoV-2019 codon usage and reservoir (not snakes v2),” Virological, January 24, 2020,
…
and-reservoir-not-snakes-v2/339. 9. Zhengli Shi… sequenced: Jane Qiu, “How China’s ‘Bat Woman’ Hunted Down Viruses from SARS to the New Coronavirus,” Scientific American, April 27, 2020, www.scientificamerican.com/article/how-chinas-bat-woman-hunted-down-viruses-from-sars-to-the-new-coronavirus1. 10. Covid-19
…
has a $2.5 trillion problem. Here’s how to solve it,” New York Times, April 20, 2020, www.nytimes.com/2020/04/20/opinion/coronavirus-economy-bailout.html. 30. Besides our biological… infection: Mark Schaller, “The behavioural immune system and the psychology of human sociality,” Philosophical Transactions of the Royal
by J. David McSwane · 11 Apr 2022 · 368pp · 102,379 words
by Michael Greger, M.D., FACLM · 1,072pp · 237,186 words
by Steven W. Thrasher · 1 Aug 2022 · 361pp · 110,233 words
by Jeremy Farrar and Anjana Ahuja · 15 Jan 2021 · 245pp · 71,886 words
by Lawrence Wright · 7 Jun 2021 · 391pp · 112,312 words
by Stephen Macedo and Frances Lee · 10 Mar 2025 · 393pp · 146,371 words
by Dr Dominic Pimenta · 2 Sep 2020 · 304pp · 95,306 words
by Lee McIntyre · 14 Sep 2021 · 407pp · 108,030 words
by Rachel Clarke · 26 Jan 2021 · 199pp · 63,844 words
by Sarah Gilbert and Catherine Green · 7 Jul 2021 · 296pp · 96,568 words
by Jeanna Smialek · 27 Feb 2023 · 601pp · 135,202 words
by Noreena Hertz · 13 May 2020 · 506pp · 133,134 words
by Fareed Zakaria · 5 Oct 2020 · 289pp · 86,165 words
by Murong Xuecun · 7 Mar 2023 · 236pp · 73,008 words
by David Heath · 18 Jan 2022
by Jennifer Carlson · 2 May 2023 · 279pp · 100,877 words
by Jamie K. McCallum · 15 Nov 2022 · 349pp · 99,230 words
by Harsha Walia · 9 Feb 2021
by Stanley McChrystal and Anna Butrico · 4 Oct 2021 · 489pp · 106,008 words
by Victor Davis Hanson · 15 Nov 2021 · 458pp · 132,912 words
by Daniel Yergin · 14 Sep 2020
by Nick Timiraos · 1 Mar 2022 · 357pp · 107,984 words
by David Spiegelhalter and Anthony Masters · 28 Oct 2021
by Vicky Spratt · 18 May 2022 · 371pp · 122,273 words
by Jeff Berwick and Charlie Robinson · 14 Apr 2020 · 491pp · 141,690 words
by Jacob Helberg · 11 Oct 2021 · 521pp · 118,183 words
by Peter Walker · 21 Jan 2021 · 372pp · 98,659 words
by Richard Horton · 31 May 2020 · 106pp · 33,210 words
by Michael Mosley · 1 Jun 2020 · 89pp · 27,057 words
by Bill Gates · 2 May 2022 · 406pp · 88,977 words
by David Quammen · 30 Sep 2012 · 669pp · 195,743 words
by Ronald J. Deibert · 14 Aug 2020
by Christopher Leonard · 11 Jan 2022 · 416pp · 124,469 words
by Martin Ford · 13 Sep 2021 · 288pp · 86,995 words
by Philippe Legrain · 14 Oct 2020 · 521pp · 110,286 words
by Peter S. Goodman · 11 Jun 2024 · 528pp · 127,605 words
by Alec MacGillis · 16 Mar 2021 · 426pp · 136,925 words
by Christopher Mims · 13 Sep 2021 · 385pp · 112,842 words
by Grace Blakeley · 14 Oct 2020 · 82pp · 24,150 words
by Michael Lewis · 3 May 2021 · 285pp · 98,832 words
by Alice Ross · 19 Nov 2020 · 197pp · 53,831 words
by John Micklethwait and Adrian Wooldridge · 1 Sep 2020 · 134pp · 41,085 words
by Nancy Jo Sales · 17 May 2021 · 445pp · 135,648 words
by Jane McGonigal · 22 Mar 2022 · 420pp · 135,569 words
by Mark Honigsbaum · 8 Apr 2019 · 529pp · 150,263 words
by Tim Schwab · 13 Nov 2023 · 618pp · 179,407 words
by J. B. MacKinnon · 14 May 2021 · 368pp · 109,432 words
by J. K. Lasser Institute · 21 Dec 2021
by Andrew Yang · 15 Nov 2021
by Sinan Aral · 14 Sep 2020 · 475pp · 134,707 words
by Rowan Hooper · 15 Jan 2020 · 285pp · 86,858 words
by James Ball · 19 Jul 2023 · 317pp · 87,048 words
by Geert Mak · 27 Oct 2021 · 722pp · 223,701 words
by Fiona Hill · 4 Oct 2021 · 569pp · 165,510 words
by Eric Berkowitz · 3 May 2021 · 412pp · 115,048 words
by Tim Harford · 2 Feb 2021 · 428pp · 103,544 words
by Chris Grey · 22 Jun 2021 · 334pp · 91,722 words
by Sathnam Sanghera · 28 Jan 2021 · 430pp · 111,038 words
by Isabel Kershner · 16 May 2023 · 472pp · 145,476 words
by Harold James · 15 Jan 2023 · 469pp · 137,880 words
by Grace Blakeley · 11 Mar 2024 · 371pp · 137,268 words
by Roxanne Khamsi; · 21 Apr 2026 · 335pp · 91,958 words
by Alan Rusbridger · 26 Nov 2020 · 371pp · 109,320 words
by Klaus Schwab and Peter Vanham · 27 Jan 2021 · 460pp · 107,454 words
by Eswar S. Prasad · 27 Sep 2021 · 661pp · 185,701 words
by Ernest Scheyder · 30 Jan 2024 · 355pp · 133,726 words
by Klaus Schwab · 7 Jan 2021 · 460pp · 107,454 words
by Sarah Jaffe · 26 Jan 2021 · 490pp · 153,455 words
by Colin Lancaster · 3 May 2021 · 245pp · 75,397 words
by Paul Scharre · 18 Jan 2023
by Scott Patterson · 5 Jun 2023 · 289pp · 95,046 words
by Javier Blas and Jack Farchy · 25 Feb 2021 · 565pp · 134,138 words
by Brad Stone · 10 May 2021 · 569pp · 156,139 words
by Juli Berwald · 4 Apr 2022 · 495pp · 114,451 words
by Anya Kamenetz · 23 Aug 2022 · 347pp · 103,518 words
by Gabrielle Bluestone · 5 Apr 2021 · 329pp · 100,162 words
by Dade Hayes and Dawn Chmielewski · 18 Apr 2022 · 414pp · 117,581 words
by Michael Smith and Jonathan Franklin · 14 Jul 2022 · 244pp · 78,238 words
by Rush Doshi · 24 Jun 2021 · 816pp · 191,889 words
by Crawford, Dorothy H. · 27 Jul 2011 · 161pp · 37,042 words
by Jesselyn Cook · 22 Jul 2024 · 321pp · 95,778 words
by Anne Kim · 384pp · 112,825 words
by Ezra Klein and Derek Thompson · 18 Mar 2025 · 227pp · 84,566 words
by Malcolm Gladwell · 1 Oct 2024 · 283pp · 85,644 words
by Anu Bradford · 25 Sep 2023 · 898pp · 236,779 words
by Azeem Azhar · 6 Sep 2021 · 447pp · 111,991 words
by Max Chafkin · 14 Sep 2021 · 524pp · 130,909 words
by Elizabeth Williamson · 8 Mar 2022 · 574pp · 148,233 words
by Kevin Davies · 5 Oct 2020 · 741pp · 164,057 words
by Michiko Kakutani · 20 Feb 2024 · 262pp · 69,328 words
by Max Fisher · 5 Sep 2022 · 439pp · 131,081 words
by Jordan Ellenberg · 14 May 2021 · 665pp · 159,350 words
by Owen Jones · 23 Sep 2020 · 387pp · 123,237 words
by Michael J. Sandel · 9 Sep 2020 · 493pp · 98,982 words
by Andrew Ross · 25 Oct 2021 · 301pp · 90,276 words
by Geoffrey Cain · 28 Jun 2021 · 340pp · 90,674 words
by Kristen R. Ghodsee · 16 May 2023 · 302pp · 112,390 words
by Brett Chistophers · 25 Apr 2023 · 404pp · 106,233 words
by Jazmine Ulloa · 3 Mar 2026 · 395pp · 116,052 words
by Kai-Fu Lee and Qiufan Chen · 13 Sep 2021
by James Surowiecki · 1 Jan 2004 · 326pp · 106,053 words
by Sandra Hempel · 15 Sep 2018
by Felix Marquardt · 7 Jul 2021 · 250pp · 75,151 words
by Anupreeta Das · 12 Aug 2024 · 315pp · 115,894 words
by Henry Grabar · 8 May 2023 · 413pp · 115,274 words
by Tom Chivers and David Chivers · 18 Mar 2021 · 172pp · 51,837 words
by Eric Garcia · 2 Aug 2021 · 398pp · 96,909 words
by Joe Kloc · 14 Apr 2025 · 249pp · 71,929 words
by Phoebe Robinson · 14 Oct 2021 · 265pp · 93,354 words
by New Scientist and Helen Thomson · 7 Jan 2021 · 442pp · 85,640 words
by Dambisa Moyo · 3 May 2021 · 272pp · 76,154 words
by Donald MacKenzie · 24 May 2021 · 400pp · 121,988 words
by Yascha Mounk · 26 Sep 2023
by Douglas Rushkoff · 7 Sep 2022 · 205pp · 61,903 words
by Cate Sevilla · 14 Jan 2021
by Kurt Wagner · 20 Feb 2024 · 332pp · 127,754 words
by Alan Murray · 15 Dec 2022 · 263pp · 77,786 words
by Jack Brown · 14 Jul 2021 · 101pp · 24,949 words
by Johan Norberg · 14 Sep 2020 · 505pp · 138,917 words
by Mark R. Levin · 12 Jul 2021 · 314pp · 88,524 words
by Kurt Andersen · 14 Sep 2020 · 486pp · 150,849 words
by Eben Kirksey · 10 Nov 2020 · 599pp · 98,564 words
by Jonathan Shapiro and James Eyers · 2 Aug 2021 · 444pp · 124,631 words
by Jason Hickel · 12 Aug 2020 · 286pp · 87,168 words
by F. Perry Wilson · 24 Jan 2023 · 286pp · 92,521 words
by Philipp Carlsson-Szlezak and Paul Swartz · 8 Jul 2024 · 259pp · 89,637 words
by Thomas Chatterton Williams · 4 Aug 2025 · 242pp · 76,315 words
by Jan Lucassen · 26 Jul 2021 · 869pp · 239,167 words
by Alex Edmans · 13 May 2024 · 315pp · 87,035 words
by Jennifer D Walker, Auburn Scallon and Moon Travel Guides · 15 Oct 2024 · 806pp · 221,571 words
by Adrian Hon · 14 Sep 2022 · 371pp · 107,141 words
by Jacob Siegel · 24 Mar 2026 · 348pp · 103,246 words
by Ben Shapiro · 26 Jul 2021 · 309pp · 81,243 words
by Michael Bhaskar · 2 Nov 2021
by Andrew Steele · 24 Dec 2020 · 399pp · 118,576 words
by Bruce Schneier · 7 Feb 2023 · 306pp · 82,909 words
by Daniel Knowles · 27 Mar 2023 · 278pp · 91,332 words
by Vivek Ramaswamy · 16 Aug 2021 · 344pp · 104,522 words
by Ray Kurzweil · 25 Jun 2024
by Nate Silver · 12 Aug 2024 · 848pp · 227,015 words
by Shibani Mahtani and Timothy McLaughlin · 7 Nov 2023 · 348pp · 110,533 words
by Jenny Kleeman · 13 Mar 2024 · 334pp · 96,342 words
by Frank Pasquale · 14 May 2020 · 1,172pp · 114,305 words
by Alec Ross · 13 Sep 2021 · 363pp · 109,077 words
by Kelly Weill · 22 Feb 2022
by Amy B. Zegart · 6 Nov 2021
by Nicole Perlroth · 9 Feb 2021 · 651pp · 186,130 words
by Kenneth Cukier, Viktor Mayer-Schönberger and Francis de Véricourt · 10 May 2021 · 291pp · 80,068 words
by Nick Wallis · 18 Nov 2021 · 705pp · 192,650 words
by Michal Zalewski · 11 Jan 2022 · 337pp · 96,666 words
by Talia Lavin · 14 Jul 2020 · 231pp · 71,299 words
by Daniel Simons and Christopher Chabris · 10 Jul 2023 · 338pp · 104,815 words
by Beth Macy · 15 Aug 2022 · 389pp · 111,372 words
by Oliver Burkeman · 9 Aug 2021 · 206pp · 68,757 words
by Diane Coyle · 11 Oct 2021 · 305pp · 75,697 words
by Colin Yeo; · 15 Feb 2020 · 393pp · 102,801 words
by Tsedal Neeley · 14 Oct 2021 · 223pp · 60,936 words
by Po Bronson · 14 Jul 2020 · 320pp · 95,629 words
by Tom Standage · 16 Aug 2021 · 290pp · 85,847 words
by Charles Goodhart and Manoj Pradhan · 8 Aug 2020 · 438pp · 84,256 words
by Brett Christophers · 12 Mar 2024 · 557pp · 154,324 words
by Lionel Barber · 5 Nov 2020
by John Abramson · 15 Dec 2022 · 362pp · 97,473 words
by Oliver Franklin-Wallis · 21 Jun 2023 · 309pp · 121,279 words
by Joe Aston · 27 Oct 2024 · 362pp · 130,141 words
by Susan Linn · 12 Sep 2022 · 415pp · 102,982 words
by Karen Cheung · 15 Feb 2022 · 297pp · 96,945 words
by William Davies · 28 Sep 2020 · 210pp · 65,833 words
by Michael Shellenberger · 11 Oct 2021 · 572pp · 124,222 words
by Devon Price · 5 Jan 2021 · 362pp · 87,462 words
by John M. Barry · 9 Feb 2004 · 667pp · 186,968 words
by Katherine M. Gehl and Michael E. Porter · 14 Sep 2020 · 627pp · 89,295 words
by Isabel Wilkerson · 14 Sep 2020 · 470pp · 137,882 words
by Robert Reffkin · 4 May 2021 · 210pp · 62,278 words
by Alissa Quart · 14 Mar 2023 · 304pp · 86,028 words
by Julia Hobsbawm · 11 Apr 2022 · 172pp · 50,777 words
by Sebastian Mallaby · 1 Feb 2022 · 935pp · 197,338 words
by Renee Dudley and Daniel Golden · 24 Oct 2022 · 392pp · 114,189 words
by Naomi Klein · 11 Sep 2023
by Angus Hanton · 25 Mar 2024 · 277pp · 81,718 words
by Duncan Mavin · 20 Jul 2022 · 345pp · 100,989 words
by Gary Gerstle · 14 Oct 2022 · 655pp · 156,367 words
by Jeff Goodell · 10 Jul 2023 · 347pp · 108,323 words
by John Cassidy · 12 May 2025 · 774pp · 238,244 words
by Madhumita Murgia · 20 Mar 2024 · 336pp · 91,806 words
by Brian Goldstone · 25 Mar 2025 · 512pp · 153,059 words
by David Sedaris · 30 May 2022 · 206pp · 64,212 words
by Rob Reich, Mehran Sahami and Jeremy M. Weinstein · 6 Sep 2021
by Pamela Paul · 14 Oct 2021 · 194pp · 54,355 words
by Jonathan Rauch · 21 Jun 2021 · 446pp · 109,157 words
by Kenneth Payne · 16 Jun 2021 · 339pp · 92,785 words
by Sebastien Page · 4 Nov 2020 · 367pp · 97,136 words
by David Frum · 25 May 2020 · 319pp · 75,257 words
by Atsuo Inoue · 18 Nov 2021 · 295pp · 89,441 words
by Jamie Raskin · 4 Jan 2022 · 450pp · 144,939 words
by Julie Battilana and Tiziana Casciaro · 30 Aug 2021 · 345pp · 92,063 words
by Jacob Ward · 25 Jan 2022 · 292pp · 94,660 words
by Alexander Zaitchik · 7 Jan 2022 · 341pp · 98,954 words
by Scott Davis, Carter Copeland and Rob Wertheimer · 13 Jul 2020 · 372pp · 101,678 words
by Jake Bittle · 21 Feb 2023 · 296pp · 118,126 words
by Alec Nevala-Lee · 1 Aug 2022 · 864pp · 222,565 words
by Carl Zimmer · 9 Mar 2021 · 392pp · 109,945 words
by Henry Marsh · 167pp · 57,175 words
by Aaron Benanav · 3 Nov 2020 · 175pp · 45,815 words
by James. Davies · 15 Nov 2021 · 307pp · 88,085 words
by Andrew McAfee · 14 Nov 2023 · 381pp · 113,173 words
by Tim Higgins · 2 Aug 2021 · 430pp · 135,418 words
by Marcos González Hernando and Gerry Mitchell · 23 May 2023
by Ian Johnson · 26 Sep 2023 · 407pp · 119,073 words
by Rob Copeland · 7 Nov 2023 · 412pp · 122,655 words
by Guillaume Pitron · 14 Jun 2023 · 271pp · 79,355 words
by Beth Shapiro · 15 Dec 2021 · 338pp · 105,112 words
by Jamieson Webster · 20 Feb 2025 · 198pp · 63,059 words
by Carrie-Marie Bratley · 15 Mar 2021 · 743pp · 193,663 words
by Mark Bergen · 5 Sep 2022 · 642pp · 141,888 words
by Matthew Cobb · 15 Nov 2022 · 772pp · 150,109 words
by Edward Fishman · 25 Feb 2025 · 884pp · 221,861 words
by Walt Bogdanich and Michael Forsythe · 3 Oct 2022 · 689pp · 134,457 words
by Maria Ressa · 19 Oct 2022
by Christian Wolmar · 5 Nov 2020 · 352pp · 98,424 words
by Mo Gawdat · 29 Sep 2021 · 259pp · 84,261 words
by Matthew Williams · 23 Mar 2021 · 592pp · 125,186 words
by Bill Gates · 16 Feb 2021 · 314pp · 75,678 words
by Sam Freedman · 10 Jul 2024 · 368pp · 101,133 words
by Heather Heying and Bret Weinstein · 14 Sep 2021 · 384pp · 105,110 words
by Kathryn Paige Harden · 20 Sep 2021 · 375pp · 102,166 words
by Steven Pinker · 14 Oct 2021 · 533pp · 125,495 words
by Alex von Tunzelmann · 7 Jul 2021 · 337pp · 87,236 words
by Scott J. Shapiro · 523pp · 154,042 words
by Bent Flyvbjerg and Dan Gardner · 16 Feb 2023 · 353pp · 97,029 words
by Garrett Neiman · 19 Jun 2023 · 386pp · 112,064 words
by Kate Conger and Ryan Mac · 17 Sep 2024
by Kashmir Hill · 19 Sep 2023 · 487pp · 124,008 words
by Sheera Frenkel and Cecilia Kang · 12 Jul 2021 · 372pp · 100,947 words
by Westaby, Stephen · 1 Feb 2023
by Johan Norberg · 14 Jun 2023 · 295pp · 87,204 words
by Azam Ahmed · 26 Sep 2023 · 483pp · 129,263 words
by Cal Newport · 5 Mar 2024 · 233pp · 65,893 words
by William MacAskill · 31 Aug 2022 · 451pp · 125,201 words
by Nouriel Roubini · 17 Oct 2022 · 328pp · 96,678 words
by Eliot Brown and Maureen Farrell · 19 Jul 2021 · 460pp · 130,820 words
by Matt Chorley · 8 Feb 2024 · 254pp · 75,897 words
by Daniel Susskind · 16 Apr 2024 · 358pp · 109,930 words
by Rick Wartzman · 15 Nov 2022 · 215pp · 69,370 words
by Julie Meade · 7 Aug 2023 · 527pp · 131,002 words
by Jennifer Pahlka · 12 Jun 2023 · 288pp · 96,204 words
by Brian Klaas · 23 Jan 2024 · 250pp · 96,870 words
by Adrian Wooldridge · 7 Apr 2026 · 342pp · 129,097 words
by Insight Guides · 6 Dec 2024 · 415pp · 110,831 words
by Ted Seides · 23 Mar 2021 · 199pp · 48,162 words
by Frank Furedi · 6 Sep 2021 · 535pp · 103,761 words
by Vaudine England · 16 May 2023 · 308pp · 122,100 words
by Robin Wigglesworth · 11 Oct 2021 · 432pp · 106,612 words
by Stephanie Marie Seferian · 19 Jan 2021
by Quinn Slobodian · 4 Apr 2023 · 360pp · 107,124 words
by Zoë Schiffer · 13 Feb 2024 · 343pp · 92,693 words
by Lionel Barber · 3 Oct 2024 · 424pp · 123,730 words
by Matthew Yglesias · 14 Sep 2020
by Peter Robison · 29 Nov 2021 · 382pp · 105,657 words
by Claudia Goldin · 11 Oct 2021 · 445pp · 122,877 words
by Mark Mazower · 4 Nov 2021 · 887pp · 242,125 words
by Elizabeth Kolbert · 15 Mar 2021 · 221pp · 59,755 words
by Michael Shellenberger · 28 Jun 2020
by Stuart Ritchie · 20 Jul 2020
by Ali Tamaseb · 14 Sep 2021 · 251pp · 80,831 words
by Jonathan Haskel and Stian Westlake · 4 Apr 2022 · 338pp · 85,566 words
by Matthew Campbell and Kit Chellel · 2 May 2022 · 363pp · 98,496 words
by Cathy O'Neil · 15 Mar 2022 · 318pp · 73,713 words
by Rose Hackman · 27 Mar 2023
by Chris Bruntlett and Melissa Bruntlett · 28 Jun 2021 · 225pp · 70,590 words
by Jonathan Hillman · 28 Sep 2020 · 388pp · 99,023 words
by Jeanette Winterson · 15 Mar 2021 · 256pp · 73,068 words
by Roma Agrawal · 2 Mar 2023 · 290pp · 80,461 words
by Johannes Krause and Thomas Trappe · 8 Apr 2021 · 218pp · 62,621 words
by Daniel Sokatch · 18 Oct 2021 · 556pp · 95,955 words
by Hannah Ritchie · 9 Jan 2024 · 335pp · 101,992 words
by Andrew Simms · 314pp · 81,529 words
by Rebecca Giblin and Cory Doctorow · 26 Sep 2022 · 396pp · 113,613 words
by Raj M. Shah and Christopher Kirchhoff · 8 Jul 2024 · 272pp · 103,638 words
by Yascha Mounk · 19 Apr 2022 · 442pp · 112,155 words
by Michael A. Heller and James Salzman · 2 Mar 2021 · 332pp · 100,245 words
by Evan Friss · 5 Aug 2024 · 493pp · 120,793 words
by Ian Goldin and Tom Lee-Devlin · 21 Jun 2023 · 248pp · 73,689 words
by Temple Grandin, Ph.d. · 11 Oct 2022
by Mustafa Suleyman · 4 Sep 2023 · 444pp · 117,770 words
by Ted Conover · 1 Nov 2022 · 391pp · 106,255 words
by Gottfried Leibbrandt and Natasha de Teran · 14 Jul 2021 · 326pp · 91,532 words
by Daron Acemoglu and Simon Johnson · 15 May 2023 · 619pp · 177,548 words
by Pete Dyson and Rory Sutherland · 15 Jan 2021 · 342pp · 72,927 words
by Sujeet Indap and Max Frumes · 16 Mar 2021 · 362pp · 116,497 words
by Adam Becker · 14 Jun 2025 · 381pp · 119,533 words
by Kevin Roose · 9 Mar 2021 · 208pp · 57,602 words
by Patrick Radden Keefe · 12 Apr 2021 · 712pp · 212,334 words
by Scott Weidensaul · 29 Mar 2021 · 415pp · 136,343 words
by Gabriel Winant · 23 Mar 2021 · 563pp · 136,190 words
by Liz Pelly · 7 Jan 2025 · 293pp · 104,461 words
by Bill Bailey · 14 Oct 2020 · 112pp · 34,520 words
by James Suzman · 2 Sep 2020 · 909pp · 130,170 words
by Jacob Silverman · 9 Oct 2025 · 312pp · 103,645 words
by Nicholas Wapshott · 2 Aug 2021 · 453pp · 122,586 words
by Jess Zimmerman · 9 Mar 2021 · 224pp · 74,019 words
by Tim Marshall · 14 Oct 2021 · 383pp · 105,387 words
by Roger L. Martin · 28 Sep 2020 · 600pp · 72,502 words
by Yves Hilpisch · 8 Dec 2020 · 1,082pp · 87,792 words
by Elliot Ackerman and James Admiral Stavridis · 15 Mar 2021 · 297pp · 89,292 words
by Jeffrey D. Sachs · 2 Jun 2020
by Barry Meier · 17 May 2021 · 319pp · 89,192 words
by Tripp Mickle · 2 May 2022 · 535pp · 149,752 words
by Dieter Helm · 2 Sep 2020 · 304pp · 90,084 words
by Edward McClelland · 2 Feb 2021 · 264pp · 74,785 words
by Ehsan Masood · 4 Mar 2021 · 303pp · 74,206 words
by Bradley Hope and Justin Scheck · 14 Sep 2020 · 339pp · 103,546 words
by Casey Michel · 23 Nov 2021 · 466pp · 116,165 words
by Dominique Mielle · 6 Sep 2021 · 195pp · 63,455 words
by Jill Lepore · 14 Sep 2020 · 467pp · 149,632 words
by Vivek H. Murthy, M.D. · 5 Mar 2020 · 405pp · 112,470 words
by Spencer Jakab · 1 Feb 2022 · 420pp · 94,064 words
by Greta Thunberg · 14 Feb 2023 · 651pp · 162,060 words
by Sergey Young · 23 Aug 2021 · 326pp · 88,968 words
by David Skelton · 28 Jun 2021 · 226pp · 58,341 words
by Simon Clark and Will Louch · 14 Jul 2021 · 403pp · 105,550 words
by Jeff Sharlet · 21 Mar 2023 · 308pp · 97,480 words
by Tamara Kneese · 14 Aug 2023 · 284pp · 75,744 words
by Vaclav Smil · 4 May 2021 · 252pp · 60,959 words
by Lonely Planet · 1,166pp · 301,688 words
by Anna Kaminski;Hugh McNaughtan · 640pp · 160,013 words
by David G. Blanchflower · 12 Apr 2021 · 566pp · 160,453 words
by Nicklas Brendborg · 17 Jan 2023 · 222pp · 68,595 words
by AA.VV. · 26 Jun 2021 · 199pp · 62,204 words
by Nicholas Carr · 28 Jan 2025 · 231pp · 85,135 words
by G. Elliott Morris · 11 Jul 2022 · 252pp · 71,176 words
by Eric J. Johnson · 12 Oct 2021 · 362pp · 103,087 words
by Christopher Miller · 17 Jul 2023 · 469pp · 149,526 words
by Robert D. Kaplan · 11 Apr 2022 · 500pp · 115,119 words
by Hawon Jung · 21 Mar 2023 · 401pp · 112,589 words
by Walter Isaacson · 11 Sep 2023 · 562pp · 201,502 words
by Fodor's Travel Guides · 2 Aug 2023 · 695pp · 189,074 words
by Premilla Nadasen · 10 Oct 2023 · 288pp · 82,972 words
by Fredrik Deboer · 4 Sep 2023 · 211pp · 78,547 words
by Russell Jones · 15 Jan 2023 · 463pp · 140,499 words
by Arthur Turrell · 2 Aug 2021 · 297pp · 84,447 words
by Katherine Blunt · 29 Aug 2022 · 470pp · 107,074 words
by Richard Rumelt · 27 Apr 2022 · 363pp · 109,834 words
by Nick Romeo · 15 Jan 2024 · 343pp · 103,376 words
by Alan Weisman · 21 Apr 2025 · 599pp · 149,014 words
by Stay European · 3 Oct 2021 · 940pp · 16,301 words
by Samuel Earle · 3 May 2023 · 245pp · 88,158 words
by Liz Nugent · 2 Mar 2023 · 355pp · 103,988 words
by James Ball and Kristie Lofland · 17 Aug 2020 · 26pp · 5,240 words
by Bernadett Varga · 14 Aug 2022
by Amanda Montell · 14 Jun 2021 · 244pp · 73,700 words
by Orly Lobel · 17 Oct 2022 · 370pp · 112,809 words
by Zeke Faux · 11 Sep 2023 · 385pp · 106,848 words
by Yuval Noah Harari · 9 Sep 2024 · 566pp · 169,013 words
by Keir Giles · 24 Oct 2024 · 296pp · 81,440 words
by Ian Kumekawa · 6 May 2025 · 422pp · 112,638 words
by Jason M. Barr · 13 May 2024 · 292pp · 107,998 words
by M. E. Sarotte · 29 Nov 2021 · 791pp · 222,536 words
by Jo Marchant · 9 Dec 2025 · 365pp · 105,070 words
by Peter H. Diamandis and Steven Kotler · 13 Apr 2026 · 225pp · 76,418 words
by Noam Scheiber · 6 Apr 2026 · 399pp · 120,332 words
by Michael Easter · 25 Sep 2023 · 318pp · 95,383 words
by Matt Alt · 14 Apr 2020
by Ray Kurzweil · 14 Jul 2005 · 761pp · 231,902 words
by Michael Spitzer · 31 Mar 2021 · 632pp · 163,143 words
by Tom Eisenmann · 29 Mar 2021 · 387pp · 106,753 words
by Brian Portnoy and Joshua Brown · 17 Nov 2020 · 149pp · 43,747 words
by Kenneth Rogoff · 27 Feb 2025 · 330pp · 127,791 words
by Colin Bryar and Bill Carr · 9 Feb 2021 · 302pp · 100,493 words
by Selina Todd · 11 Feb 2021 · 598pp · 150,801 words
by Megan Kimble · 2 Apr 2024 · 430pp · 117,211 words
by Jeff John Roberts · 15 Dec 2020 · 226pp · 65,516 words
by Brett L. Markham · 14 Apr 2010 · 252pp · 73,387 words
by Vaclav Smil · 23 Sep 2019
by Matthew Brennan · 9 Oct 2020 · 282pp · 63,385 words
by Ben Mezrich · 6 Sep 2021 · 239pp · 74,845 words
by David G. W. Birch and Victoria Richardson · 28 Apr 2024 · 249pp · 74,201 words
by Eliot Higgins · 2 Mar 2021 · 277pp · 70,506 words
by George Packer · 14 Jun 2021 · 173pp · 55,328 words
by Jeff Lawson · 12 Jan 2021 · 282pp · 85,658 words
by Alan Weisman · 5 Aug 2008 · 482pp · 106,041 words
by Nick Bostrom and Milan M. Cirkovic · 2 Jul 2008
by Arvid Kahl · 24 Jun 2020 · 461pp · 106,027 words
by Chuck Wendig · 1 Jul 2019 · 1,028pp · 267,392 words
by Gregg Easterbrook · 20 Feb 2018 · 424pp · 119,679 words
by Lonely Planet
by Morgan Housel · 7 Sep 2020 · 209pp · 53,175 words
by Edward Chancellor · 31 May 2000 · 860pp · 227,491 words
by Anil Seth · 29 Aug 2021 · 418pp · 102,597 words
by Ryan Dezember · 13 Jul 2020 · 279pp · 87,875 words
by Rebecca Walker · 15 Mar 2022 · 322pp · 106,663 words
by Tom Burgis · 7 Sep 2020 · 476pp · 139,761 words
by Hubert Joly · 14 Jun 2021 · 265pp · 75,202 words
by James Poskett · 22 Mar 2022 · 564pp · 168,696 words
by Mary L. Trump · 13 Jul 2020 · 269pp · 72,752 words
by Stefan Al · 11 Apr 2022 · 300pp · 81,293 words
by Robert B. Zoellick · 3 Aug 2020
by Malcolm Harris · 14 Feb 2023 · 864pp · 272,918 words
by Mary Childs · 15 Mar 2022 · 367pp · 110,161 words
by Jean M. Twenge · 25 Apr 2023 · 541pp · 173,676 words
by Brent Donnelly · 11 May 2021
by Justin E. H. Smith · 22 Mar 2022 · 198pp · 59,351 words
by Michael Strevens · 12 Oct 2020
by Edward Chancellor · 15 Aug 2022 · 829pp · 187,394 words
by Tracy Kidder · 17 Jan 2023 · 270pp · 88,213 words
by Reeves Wiedeman · 19 Oct 2020 · 303pp · 100,516 words
by Oliver Bullough · 10 Mar 2022 · 257pp · 80,698 words
by Joanna Schwartz · 14 Feb 2023 · 422pp · 114,817 words
by Rebecca Boyle · 16 Jan 2024 · 354pp · 109,574 words
by Will Grant · 14 Oct 2023 · 246pp · 82,965 words
by James Dyson · 6 Sep 2021 · 312pp · 108,194 words
by Rough Guides · 24 May 2022
by Culture Smart! · 15 Jun 201 · 124pp · 37,476 words
by Joshua Becker · 19 Apr 2022 · 215pp · 62,479 words
by Adrian Wooldridge · 2 Jun 2021 · 693pp · 169,849 words
by Rosie Wilby · 26 May 2021 · 227pp · 67,264 words
by J. B. Handley and Jamison Handley · 23 Mar 2021 · 130pp · 42,093 words
by Hans Kundnani · 16 Aug 2023 · 198pp · 54,815 words
by Herminia Ibarra · 17 Oct 2023 · 200pp · 67,943 words
by Lucy Kellaway · 30 Jun 2021 · 184pp · 60,229 words
by Peter Biskind · 6 Nov 2023 · 543pp · 143,084 words
by Ed Conway · 15 Jun 2023 · 515pp · 152,128 words
by Arthur Der Weduwen and Andrew Pettegree · 14 Oct 2021 · 457pp · 173,326 words
by Daniel Crosby · 19 Sep 2024 · 229pp · 73,085 words
by Nellie Bowles · 13 May 2024 · 207pp · 62,397 words
by Mehrsa Baradaran · 7 May 2024 · 470pp · 158,007 words
by Dk Eyewitness · 168pp · 33,675 words
by Mehdi Hasan · 27 Feb 2023 · 307pp · 93,073 words
by Michael Fabey · 13 Jun 2022 · 319pp · 102,839 words
by Anil Ananthaswamy · 15 Jul 2024 · 416pp · 118,522 words
by AA.VV. · 23 May 2022 · 192pp · 59,615 words
by Byrne Hobart and Tobias Huber · 29 Oct 2024 · 292pp · 106,826 words
by Patrick McGee · 13 May 2025 · 377pp · 138,306 words
by David Bellos and Alexandre Montagu · 23 Jan 2024 · 305pp · 101,093 words
by Edward Slingerland · 31 May 2021
by Ben Tarnoff · 13 Jun 2022 · 234pp · 67,589 words
by DK · 171pp · 34,369 words
by Michael Dobbs · 24 May 2021 · 426pp · 117,722 words
by Brian Merchant · 25 Sep 2023 · 524pp · 154,652 words
by Katherine Clarke · 13 Jun 2023 · 454pp · 127,319 words
by Rough Guides · 14 Oct 2024 · 882pp · 240,215 words
by Eva Dou · 14 Jan 2025 · 394pp · 110,159 words
by Gaia Vince · 22 Aug 2022 · 302pp · 92,206 words
by Dk Eyewitness
by Oliver Burkeman · 8 Oct 2024 · 123pp · 43,370 words
by Rough Guides · 14 Oct 2023 · 1,955pp · 521,661 words
by Sarah Williams · 14 Sep 2020
by Diane Coyle · 15 Apr 2025 · 321pp · 112,477 words
by Eliza Reid · 15 Jul 2021
by Erik Baker · 13 Jan 2025 · 362pp · 132,186 words
by Simon Baron-Cohen · 14 Aug 2020
by Andreas Malm · 4 Jan 2021 · 156pp · 49,653 words
by Erica Thompson · 6 Dec 2022 · 250pp · 79,360 words
by Owen Walker · 4 Mar 2021 · 278pp · 82,771 words
by J. Doyne Farmer · 24 Apr 2024 · 406pp · 114,438 words
by Sara Gibbs · 23 Jun 2021 · 263pp · 89,341 words
by Fodor's Travel Guides · 23 Aug 2022
by David William Plummer · 14 Sep 2021
by Morgan Housel · 7 Nov 2023 · 210pp · 53,743 words
by Lonely Planet
by Scott. Branson · 14 Jun 2022 · 198pp · 63,612 words
by Felix Gillette and John Koblin · 1 Nov 2022 · 575pp · 140,384 words
by Megan Greenwell · 18 Apr 2025 · 385pp · 103,818 words
by Jacob Goldstein · 14 Aug 2020 · 199pp · 64,272 words
by J. Bradford Delong · 6 Apr 2020 · 593pp · 183,240 words
by Nelson P. Repenning and Donald C. Kieffer · 26 Aug 2025 · 258pp · 85,605 words
by Hu Anyan · 240pp · 83,473 words
by David Gelles · 30 May 2022 · 318pp · 91,957 words
by Leo Hollis · 334pp · 103,106 words
by David Ariosto · 24 Mar 2026 · 433pp · 116,344 words