coronavirus

Failures of State: The Inside Story of Britain's Battle With Coronavirus

by Jonathan Calvert and George Arbuthnott  · 18 Mar 2021  · 432pp  · 143,491 words

4, Ireland First published by HarperCollinsPublishers 2021 FIRST EDITION © Jonathan Calvert and George Arbuthnott 2021 Cover design Steve Leard © HarperCollinsPublishers 2021 Sunday Times graphics on coronavirus © The Sunday Times/News Licensing While every effort has been made to trace the owners of copyright material reproduced herein and secure permissions, the publishers

…

-19 world. As investigative reporters for The Sunday Times, we produced a series of articles throughout 2020 examining the UK government’s reaction to the coronavirus crisis and attempting to understand how this country – which prided itself on its pandemic defences – managed to get it so badly wrong. Our first

…

decision – for thousands of people. A study by Imperial College London’s pandemic modellers and Oxford University’s department of statistics has estimated that coronavirus infections across the UK rocketed from an estimated 200,000 to 1.5 million in the nine days before lockdown as the prime minister agonised

…

corona) when viewed under a microscope because of the spikes protruding from their surface. Before Covid-19 appeared in 2019 there were six types of coronavirus known to infect humans, but mostly they caused mild respiratory symptoms with the exception of the Middle East Respiratory Syndrome in 2012 and Sars, which

…

who had spearheaded his country’s efforts to combat the Sars pandemic nine years earlier. Aware the men might be suffering from another Sars-related coronavirus, he advised they be tested for antibodies against Sars, which would have shown whether the men had previously contracted the virus. These tests were

…

more infectious to humans. Papers released by the Wuhan Institute of Virology between 2015 and 2017 describe how Shi’s team combined snippets of different coronaviruses to see if they could be made more transmissible to humans. They called them ‘virus infectivity experiments’. This type of ‘gain-of-function’ work

…

virus] emerged that we found that it was close to Sars-2.’ Other scientists find this indifference to a new strain of a potentially deadly coronavirus hard to believe. Nikolai Petrovsky, Professor of Medicine at Flinders University in Adelaide, South Australia, and secretary-general of the International Immunomics Society, has

…

outcome of the tests inside the market was released later that month, the Chinese state news agency Xinhua reported: ‘The results suggest that the novel coronavirus outbreak is highly relevant to the trading of wild animals.’ However, the picture was far more complicated than it first seemed. An early study

…

spreading rapidly. But in those early days of January, the Chinese scientists did not seek help from international colleagues because the existence of the new coronavirus remained a strict secret. Using a technique to amplify the virus’s genetic material, her team swiftly managed to confirm that samples from five

…

patients at the Wuhan Jinyintan Hospital had genetic sequences present in all coronaviruses. These were sent to a team led by Professor Zhang Yongzhen of the Shanghai Public Health Clinical Centre laboratory, which was able to map

…

has greatly affected the scientists and their research when they should be racing against the clock to find the means to help put the novel coronavirus outbreak under control,’ the source said. The Shanghai Health Commission refused to say what lay behind the decision. Hours after Zhang’s team released

…

, a small band of scientists, academics and enthusiasts from different countries were messaging each other, questioning whether RaTG13 might actually have been the novel coronavirus that Shi had described in her 2016 paper chronicling the results of her team’s sampling in the mine. Despite repeated requests Shi and the

…

of the crisis later unravelled, the public would become increasingly concerned about the committee’s lack of transparency. More information was emerging about the new coronavirus on the day of the first Sage meeting. Chinese scientists were warning that the virus had an unusually high infectivity rate – known as the

…

were allowed to travel across Britain at will. The researchers estimated that up to 1,900 of these passengers would have been infected with the coronavirus – guaranteeing the UK would become a centre of the subsequent pandemic. Sure enough, five days after the Cobra meeting, on Wednesday 29 January, the

…

health secretary having gone on record saying that whistle-blowers in the National Health Service should be protected. Only after the story broke – as the coronavirus was beginning to spread across the world – did Hancock relent to the growing pressure and order an inquiry in early 2020. It raised questions

…

a contract agreeing to accept a 14-day quarantine, which would be spent in hospital accommodation on Merseyside. The following day the WHO declared the coronavirus threat to be a global public health emergency because of the spread of the virus outside of China. It was an ‘unprecedented outbreak’, according

…

the newspaper’s glass London Bridge headquarters and articulated for the first time the shift we were beginning to witness in the media’s attention. ‘Coronavirus is the new Brexit,’ he said. He was correct. The story was only getting bigger and bigger as its catastrophic and devastating ramifications became

…

complacency at the heart of government. Answering questions from MPs, Hancock repeated his message that the NHS had the capacity to treat 50 to 500 coronavirus patients. He was asked by a friendly Conservative colleague, Dr Caroline Johnson MP, whether there were preparations for a wider package of measures – such

…

has since decided to pause implementation of the proposed mobile alerting system,’ it states. The last rehearsal for a pandemic before the emergence of the coronavirus hardly inspired confidence. Run by Public Health England in October 2016, the three-day operation codenamed Cygnus tested how more than 950 officials – including

…

plan had been mothballed around the time the Brexit planning got very intense in 2017.’ It meant that in the years leading up to the coronavirus outbreak, key government committee meetings on pandemic planning were repeatedly ‘bumped’ off the diary to make way for discussions about what were deemed more

…

national pandemic stockpile had been established in 2009 following the swine flu outbreak, with around £500m being spent on protective equipment. By the time the coronavirus pandemic began, the stockpile was mostly housed in a 370,000-square-foot distribution centre in Merseyside that had been built specifically for the purpose

…

’. It concluded ministers had plenty of time and ample warning but had done next to nothing. It said: ‘Despite the first reported case of coronavirus being confirmed by the chief medical officer in England on 31 January 2020, the Treasury did not announce plans for significant funding to support businesses

…

to anticipate looming problems before it was too late’ and expressed his concerns about ‘curtailed cabinet meetings’ where issues such as the economic impact of coronavirus received just five minutes of ‘discussion in January’. It had often been noted by those who worked with Johnson that he had a habit of

…

Tedros Adhanom Ghebreyesus, the World Health Organization director-general, issued a stark warning. He said the opportunity to contain the wider spread of the deadly coronavirus was slipping away. ‘The window of opportunity is narrowing, so we need to act quickly before it closes completely,’ he declared. 6 Part-Time Prime

…

was initially prevalent among younger people in the country’s ski resorts, who were either: asymptomatic; mildly affected; or their illness wasn’t recognised as coronavirus. On the day before the Conservatives’ ball, Italy had been forced to bring in the first control measures, with the country’s sports minister

…

each strain had originated by comparing it to samples taken in other countries. They found that more than 1,000 different people had brought the coronavirus into Britain, which ruled out the idea that one superspreader or ‘patient zero’ sparked the outbreak. Most of the infections in February had indeed

…

a surge in patients needing ventilation to help them breathe. They warned that weaker patients could therefore be denied life-saving care during a severe coronavirus outbreak, with senior consultants being left in the invidious position of having to decide who would be given access to ventilators and beds. Professor

…

an interest in the crisis that was gripping his nation. That morning he summoned Hancock and Whitty into Downing Street to specifically discuss concerns about coronavirus. Eight weeks after reports of the new virus had emerged and after missing all five Cobra meetings on the subject, the prime minister had

…

Monday. In a letter to the European Society of Intensive Care Medicine, they revealed that up to 10 per cent of all those infected with coronavirus in Italy had needed intensive care. This, according to the three authors of the letter – professors Maurizio Cecconi, Antonio Pesenti and Giacomo Grasselli from

…

would not be overwhelmed, as they were in Italy. That day the London Ambulance Service increased the threshold for the severity of symptoms that a coronavirus patient would have to typically exhibit before they would be taken to hospital. This had dangerous consequences. The sense of impatience with the government’

…

that week before lockdown, the health service’s burden was increasing by a third. The complacency that had allowed Johnson to sail through February believing coronavirus to be a medically ‘irrational panic’ was rapidly dissipating. His government was panicking and nothing showed this more clearly than the chancellor Rishi Sunak’s

…

a bad example. And they were also endangering lives. In times of extremis, extraordinary things happen with hardly anyone batting an eyelid. That day the Coronavirus Act – the most authoritarian new law since the Second World War, which set out the legal basis for lockdown – raced through parliament with little

…

were forced to deploy the tool or a version of it. They had been faced with an impossible situation with far too many severely ill coronavirus patients requiring intensive care when there were insufficient beds or staff available. The government-commissioned age-based ‘triage tool’ was the only guidance they

…

place in hospital had been displaced to people’s homes and the care homes. This huge increase in deaths outside hospitals was a mixture of coronavirus cases – many of which were never diagnosed – and people who were not given treatment for other conditions that they would normally have received had

…

were dispatched from hospitals into care homes that were completely open to infection and then cross-infection. A third of all care homes declared a coronavirus outbreak, with more than a thousand dealing with positive cases during the peak of infections in April, according to the National Audit Office. Chris

…

least in part, because of his stubborn libertarianism.’ And the criticism went on. Greece’s progressive daily newspaper Ethnos described Johnson as ‘more dangerous than coronavirus’, saying one of the crisis’s greatest tragedies was that ‘incompetent leaders’ such as Johnson and Donald Trump were ‘at the helm at a

…

another outbreak in Westminster and disenfranchising vulnerable MPs. The logistics of observing the two-metre social distancing rule in the Commons while voting created a ‘coronavirus conga’ in which 523 politicians had to form a queue stretching for hundreds of metres. The queue snaked across the courtyards of the Palace

…

room’, while Labour MP Geraint Davies told the Guardian: ‘This is wholly irresponsible publicity by the Conservative government, which will fuel a resurgence of coronavirus infection and death in England.’1 The Treasury quickly backed down and removed the tweet, admitting it had ‘got it wrong’. The NHS high command

…

was ‘creating population immunity’. During the interview, he called on the prime minister to subtly change his language to ‘normalise’ the September rise in coronavirus cases, arguing that it was usual for respiratory-type infections to multiply around that time of year. ‘This is a seasonal effect now, and if

…

Radio 4’s Today programme: ‘The government has consistently throughout this year been ahead of the curve in terms of proactive measures with regards to coronavirus.’ Johnson claimed sarcastically that the criticisms against him amounted to people being wise after the event, when he appeared on BBC One’s Andrew

…

Reuters, 24 May 2011. 4: Sleepwalk 1. ‘Revealed: NHS denied PPE at height of Covid-19 as supplier prioritised China’, Guardian, 20 July 2020. 2. ‘Coronavirus: Did the government get it wrong?’, Dispatches, Channel 4, 3 June 2020. 3. Ibid. 4. ‘Revealed: Value of UK pandemic stockpile fell by 40% in

…

s home’, Guardian, 21 June 2019. 9. ‘Charlotte Edwardes on Boris Johnson’s wandering hands’, The Sunday Times, 29 September 2019. 10. ‘Hospitals prepare for coronavirus epidemic to sweep Britain’, The Sunday Times, 16 February 2020. 11. ‘The prime minister’s vanishing briefs’, The Sunday Times, 23 February 2020. 12. ‘Where

…

February 2020. 7: The Action Plan 1. ‘UK has plans to deal with pandemic causing up to 315,000 deaths’, Guardian, 6 March 2020. 2. ‘Coronavirus: Did the government get it wrong?’, Dispatches, Channel 4, 3 June 2020. 3. Ibid. 8: Herd Immunity 1. ‘Boris Johnson heckled during visit to

…

Covid-19 doing well’, Guardian, 16 April 2020. 3. ‘From evasion to evisceration: How the Cummings lockdown story unfolded’, Guardian, 29 May 2020. 4. ‘Coronavirus: More than 4,000 hospital patients discharged into care homes without test’, Sky News, 17 July 2020. 5. ‘Three nurses forced to wear bin bags

…

22 May 2020. 5. ‘New witnesses cast doubt on Dominic Cummings’s lockdown claims’, Guardian, 23 May 2020. 6. ‘Chief nurse dropped from Downing Street coronavirus briefing “after refusing to back Dominic Cummings”’, Independent, 12 June 2020. 7. ‘Serious weaknesses in the UK’s current plans for suppressing covid-19 risk

…

, 403 Academy of Medical Sciences 237, 336, 338, 353 action plan, UK government (‘contain, delay, research, mitigate’ strategy) 152–66 All-Party Parliamentary Group on Coronavirus 396, 398 ambulance service 95, 190, 224, 237, 243, 247, 264, 265–7, 268, 269, 270, 273, 274–5, 282, 294, 290, 291, 392,

…

203, 401; lockdown and 296, 302, 319, 322, 329, 339, 340, 359 Conte, Giuseppe 192–3 Corbyn, Jeremy 76, 127, 137, 138, 240 Coronavirus Act (2020) 226–7 Coronavirus Clinical Characterisation Consortium 396 Cosford, Paul 64, 109 Costello, Anthony 181, 369 Covid-19 (Sars-CoV-2): asymptomatic spread of 135, 142, 144

Apollo's Arrow: The Profound and Enduring Impact of Coronavirus on the Way We Live

by Nicholas A. Christakis  · 27 Oct 2020  · 475pp  · 127,389 words

was unfolding. Along with a broad range of scientists, including epidemiologists, virologists, physicians, sociologists, and economists, I turned to Twitter to post tutorial threads on coronavirus-related topics such as the mortality rate in children and the elderly, the reasons we had to “flatten the curve,” the nature of immunity after

…

information, shut down the lab that had done this important work for “rectification.”60 SARS-2 is in the family of viruses knowns as coronaviruses. Some species of coronaviruses cause the common cold in humans; others afflict some of our domesticated animals, like pigs, cats, and chickens. Genetic sequencing showed that

…

due to the cessation of manufacturing activity.87 * * * The emergence of pandemics is not restricted to the twentieth century or to respiratory illnesses caused by coronavirus or influenza, of course. Dramatic outbreaks of infectious diseases have afflicted human beings for a long time. Pathogens are just as important to our species

…

For instance, another survey conducted at the end of April 2020 reported that 67 percent of Americans were “somewhat concerned” or “very concerned” about getting coronavirus themselves. But Americans were even more concerned that their family members would get the virus, with 79 percent expressing this fear.12 Another more clinically

…

time, in another survey conducted after mitigation efforts to flatten the disease curve were well under way, Americans became slightly less fearful of contracting the coronavirus (57 percent were worried in April compared to 51 percent in May), but they became slightly more concerned about severe financial hardship (48 percent

…

of Americans rated as “very important” the following conditions for resuming normal everyday activities at that time: (1) mandatory quarantine for anyone testing positive for coronavirus, (2) improved medical therapies to prevent or treat COVID-19, and (3) significant reduction in the number of new cases or deaths.16 * * * In

…

targeted young and healthy people would be better. But most persuasively, detailed genetic analyses of the pathogen show a pattern of descent from prior bat coronaviruses and of randomly occurring genetic mutations that are not compatible with deliberate genetic engineering.72 However, it is very difficult to totally exclude the possibility

…

organization in Florida calling itself the Genesis II Church of Health and Healing was ordered by a judge to stop selling its “sacramental dosing for coronavirus,” which consisted of a powerful bleaching agent ordinarily used as an industrial chemical.76 The organization described its purported elixir as a “miracle mineral

…

of structural power in the network, dominating the conversation and increasingly winning out against true information.101 * * * The circulation of truth and lies during the coronavirus pandemic was also heightened inadvertently by the increasing use by scientists of a new tool for communication, known as preprint servers, that in some ways

…

carefully vetted (even robust studies are improved significantly by undergoing peer review), and nonexperts usually lack the skills to evaluate its scientific validity. During the coronavirus pandemic, therefore, preprint servers contributed to dissemination of true information but also to what the WHO called an “infodemic” of false information. Online platforms

…

of this pathogen was bad enough without exaggeration of preliminary information making things worse. Another glaring example was an erroneous preprint that claimed that the coronavirus—impossibly—had insertions of genetic material from HIV. By the time scientists had debunked this study, prompting its wholesale withdrawal, it had entered into

…

and those considered blameworthy. Simpleminded Manichaean thinking surges—good versus evil, us versus them. Let’s look at some existing divisions in our society that coronavirus highlights—such as age, sex, race, and socioeconomic status—and then at some new ones it will likely foster. * * * One of the unusual features

…

combinations of gene variants. This variety could result in an immunity advantage compared to the more fixed expression in males.51 * * * Like other infectious diseases, coronavirus strikes differentially along socioeconomic lines. While this pandemic did not cause the structural inequalities in our society, it nevertheless brought them into stark relief. We

…

in the surrounding communities. The pathogen, having brewed at the factories, spread outward.65 * * * Ethnic and racial disparities in the attack rate and CFR of coronavirus also became clear not long after the pandemic struck the United States. The findings typified the usual patterns of differential burden of infectious diseases seen

…

virus vaccines are among the most effective methods of vaccination known, usually conferring very good and long-term immunity. Moderately successful veterinary vaccines for various coronavirus species (used in pigs, cows, cats, and so on) have been of the live attenuated variety, which raises hope for similar success in humans

…

part of their contribution, some scientists attempted to create genetically engineered animals that expressed the human form of the ACE2 protein (the one that the coronavirus latches onto), which would allow still other scientists to more rapidly assess the efficacy of the vaccines they were developing. A whole independent set

…

the opportunity to use our capacities for teaching and learning in order to enhance our survival. * * * One classic study of immunity and symptoms related to coronavirus (involving the 229E strain, which causes the common cold), published in 1990, involved an odd twist.85 Fifteen volunteers were deliberately infected with the virus

…

hope for our modern metropolises. Some of the most densely populated places on earth—Asian cities—have, to date, been very successful in containing the coronavirus pandemic. As we saw before, this paradox illustrates another important feature of our evolutionary heritage: the human capacity for cultural innovation and learning. Modern living

…

).29 Central nervous system symptoms were also more pronounced in that pandemic than is typical of influenza, according to historical accounts, and the OC43 coronavirus is known to be neuro-invasive.30 Another suggestive piece of evidence comes from work that indicates that the Russian flu showed a disproportionate increase

…

shape mortality function, which is unusual for influenza (remember that influenza usually manifests a more pronounced U-shaped function).31 OC43 and a particular bovine coronavirus species show remarkable similarities in their genetic sequences and in the chemical structures of the proteins that elicit an immune response. And by comparison with

…

to an Infectious Disease Hospital, Residents near the Huanan Market Found Infected,” Beijing News, January 2, 2020. 13 Anonymous, “China Detects Large Quantity of Novel Coronavirus at Wuhan Seafood Market,” XinhuaNet, January 27, 2020. 14 J.Q. Gong, “The Whistle-Giver,” People Magazine (China), March 10, 2020. 15 J.X.

…

Provincial People’s Congress Will Be Held on January 12th, 2020,” People’s Daily Online, November 29, 2019; P. Zhuang, “Chinese Laboratory That First Shared Coronavirus Genome with World Ordered Closed for ‘Rectification,’ Hindering Its COVID-19 Research,” South China Morning Post, February 28, 2020. 17 T. Reals, “Chinese Doctor Was

…

of Whistle-Blowing Doctor Li Wenliang,” South China Morning Post, March 19, 2020. 19 C. Buckley, “Chinese Doctor, Silenced After Warning of Outbreak, Dies from Coronavirus,” New York Times, February 6, 2020; Anonymous, “China Identifies 14 Hubei Frontline Workers, Including Li Wenliang, as Martyrs,” Global Times, April 2, 2020. 20

…

. 8 Anonymous, “Hospital Beds (per 1,000 People),” World Bank Data, 2015. 9 L. Frias, “Thousands of Chinese Doctors Volunteered for the Frontline of the Coronavirus Outbreak. They Are Overwhelmed, Under-Equipped, Exhausted, and Even Dying,” Business Insider, February 7, 2020. 10 M. Van Beusekom, “Doctors: COVID-19 Pushing Italian

…

the White House,” Washington Post, April 10, 2020. 63 E. Christakis, The Importance of Being Little, New York: Viking, 2015, p. 136. 64 Anonymous, “Map: Coronavirus and School Closures,” Education Week, March 6, 2020. 65 National Center for Education Statistics, “Digest of Education Statistics: Table 105.20. Enrollment in Elementary, Secondary

…

and Secondary Schools,” U.S. Department of Education Institute of Education Sciences, March 2019. 66 J. Couzin-Frankel, “Does Closing Schools Slow the Spread of Coronavirus? Past Outbreaks Provide Clues,” Science, March 10, 2020. 67 W. Van Lancker and Z. Parolin, “COVID-19, School Closures, and Child Poverty: A Social

…

Measures for Response to an Influenza Pandemic,” Paediatric Respiratory Reviews 2015; 16: 119–126; R.M. Viner et al., “School Closure and Management Practices during Coronavirus Outbreaks Including COVID-19: A Rapid Systematic Review,” Lancet Child & Adolescent Health 2020; 4: 397–404. 69 S. Hsiang, et al., “The Effect of

…

Influenza Pandemic in US Cities,” Proceedings of the National Academy of Sciences 2007; 104: 7588–7593. 74 Anonymous, “School Closures Begin as Japan Steps Up Coronavirus Fight,” Kyodo News, May 2, 2020. 75 S. Kawano and M. Kakehashi, “Substantial Impact of School Closure on the Transmission Dynamics during the Pandemic

…

-Up Service,” Los Angeles Times, April 8, 2020. 2 C. Engelbrecht and C. Kim, “Zoom Shivas and Prayer Hotlines: Ultra-Orthodox Jewish Traditions Upended by Coronavirus,” New York Times, April 16, 2020. 3 N.A. Christakis, Death Foretold: Prophecy and Prognosis in Medical Care, Chicago: University of Chicago Press, 1999;

…

S. Taylor, The Psychology of Pandemics, Newcastle upon Tyne: Cambridge Scholars Publications, 2020. 20 K. King, “Daily Cheers Give Morale Boost to Medical Workers Fighting Coronavirus,” Wall Street Journal, April 18, 2020; A. Mohdin, “Pots, Pans, Passion: Britons Clap Their Support for NHS Workers Again,” The Guardian, April 2, 2020.

…

63 D. Diamond, “Suddenly, Public Health Officials Say Social Justice Matters More Than Social Distance,” Politico, June 4, 2020. 64 M. Bebinger et al., “New Coronavirus Hot Spots Emerge across South and in California, As Northeast Slows,” NPR, June 5, 2020. 65S. Pei et al., “Differential Effects of Intervention Timing on

…

Quaresima, “Warning Letter,” United States Food and Drug Administration, March 6, 2020. 83 K. Rogers, “Trump’s Suggestion That Disinfectants Could Be Used to Treat Coronavirus Prompts Aggressive Pushback,” New York Times, April 24, 2020. 84 L. Wade, “The Secret Life of Vintage Lysol Douche Ads,” Society Pages, September 27, 2013

…

.J. Mercuro et al., “Risk of QT Interval Prolongation Associated with Use of Hydroxychloroquine with or without Concomitant Azithromycin among Hospitalized Patients Testing Positive for Coronavirus Disease 2019 (COVID-19),” JAMA Cardiology, May 1, 2020; J. Yazdany and A.H.J. Kim, “Use of Hydroxychloroquine and Chloroquine during the COVID-

…

Callousness toward AIDS Victims,” New York Times, November 7, 1987. 11 R. Brackett, “Governor Says State Will Accept Florida Residents from Cruise Ship Stricken with Coronavirus,” Weather Channel, April 1, 2020; M. Burke, K. Sanders, “Cruise Ship with Sick Passengers and Sister Ship Dock in Florida,” NBC News, April 3,

…

2020. 12 D. Quan, “‘Dreams Are Not Passports’: Remote Arctic Village Residents Recount Bizarre Encounter with Quebec Couple Fleeing Coronavirus,” The Star [Toronto], March 30, 2020. 13 Procopius, History of the Wars, trans. H.B. Dewing, Cambridge, MA: Harvard University Press, 1914, p. 453.

…

Patients, Later Rescinds Them,” Journal of Emergency Medical Services, April 22, 2020. 46 C. Huang et al., “Clinical Features of Patients Infected with 2019 Novel Coronavirus in Wuhan, China,” The Lancet 2020; 395: 497–506. 47 C.M. Petrilli et al., “Factors Associated with Hospital Admission and Critical Illness among

…

Hormones Regulate Innate Immune Cells and Promote Sex Differences in Respiratory Virus Infection,” Frontiers in Immunology 2018; 9: 1653. 50 P. Conti and A. Younes, “Coronavirus COV-19/SARS-CoV-2 Affects Women Less Than Men: Clinical Response to Viral Infection,” Journal of Biological Regulators and Homeostatic Agents 2020; 34: 32253888

…

on Time to Clinical Improvement in Patients with Severe and Life-Threatening COVID-19: A omized Clinical Trial,” JAMA, June 3, 2020. 63 D. Lowe, “Coronavirus Vaccine Prospects,” Science Translational Medicine, April 15, 2020. 64 D.R. Hopkins, The Greatest Killer: Smallpox in History, with a New Introduction, Chicago: University

…

of Chicago Press, 2002, p. 80. 65 L.J. Saif, “Animal Coronavirus Vaccines: Lessons for SARS,” Developments in Biologicals 2004; 119: 129–140. 66 H. Wang et al., “Development of an Inactivated Vaccine Candidate, BBIBP-CorV, with

…

al., “Development of an Inactivated Vaccine Candidate for SARS-CoV-2,” Science 2020; 369: 77–81; J. Cohen, “Covid-19 Vaccine Protects Monkeys from New Coronavirus, Chinese Biotech Reports,” Science, April 23, 2020. 68 F.C. Zhu et al., “Safety, Tolerability, and Immunogenicity of a Recombinant Adenovirus Type-5 Vectored

…

) for Phase 1 Study,” Moderna, February 24, 2020. 70 Anonymous, “Moderna Announces Positive Interim Phase 1 Data for Its mRNA Vaccine (mRNA-1273) against Novel Coronavirus,” Moderna, May 18, 2020. 71 Anonymous, “Moderna Reports Positive Data from Phase I COVID-19 Vaccine Trial,” Moderna, May 19, 2020. 72 G. Ramon,

…

Development Landscape,” Nature Reviews Drug Discovery 2020; 19: 305–306. 77 K.A. Callow et al., “The Time Course of the Immune Response to Experimental Coronavirus Infection of Man,” Epidemiology and Infection 1990; 105: 435–446; L.P. Wu et al., “Duration of Antibody Responses after Severe Acute Respiratory Syndrome,”

…

a Pandemic: Social Networks and the Macroeconomic Response of Consumption,” SSRN, May 17, 2020. 61 Associated Press, “U.S. Online Alcohol Sales Jump 243% during Coronavirus Pandemic,” MarketWatch, April 2, 2020. 62 W. Oremus, “What Everyone’s Getting Wrong about the Toilet Paper Shortage,” Medium Marker, April 2, 2020. 63

…

. Joseph, “Roll Call: The Importance of Teacher Attendance,” National Council on Teacher Quality, June 2014. 86 G. Viglione, “How Scientific Conferences Will Survive the Coronavirus Shock,” Nature, June 2, 2020. 87 L.B. Kahn, “The Long-Term Labor Market Consequences of Graduating from College in a Bad Economy,” Labour Economics

…

Protocol: Prospective Observational Cohort Study,” British Medical Journal 2020; 369: m1985; Y. Wu et al., “Nervous System Involvement after Infection with COVID-19 and Other Coronaviruses,” Brain, Behavior, and Immunity 2020; 87: 18–22; S.H. Wong et al., “COVID-19 and the Digestive System,” Journal of Gastroenterology and Hepatology

Aftershocks: Pandemic Politics and the End of the Old International Order

by Colin Kahl and Thomas Wright  · 23 Aug 2021  · 652pp  · 172,428 words

News, May 30, 2020, https://www.nbcnews.com/politics/donald-trump/trump-says-he-postponing-g7-summit-n1219896.     4.  Johns Hopkins University & Medicine, Coronavirus Research Center, https://coronavirus.jhu.edu/; International Monetary Fund, “Transcript of the World Economic Outlook Press Briefing,” January 26, 2021, https://www.imf.org/en/News/Articles/

…

-briefing.     5.  “United States: Cumulative Confirmed Deaths: How Do They Compare to Other Countries?” Our World in Data, accessed March 30, 2021, https://ourworldindata.org/coronavirus/country/united-states.     6.  Colin H. Kahl, States, Scarcity, and Civil Strife in the Developing World (Princeton, NJ: Princeton University Press, 2006).     7.  Thomas

…

.com/articles/world/2020-06-09/when-system-fails.     5.  COVID-19 Dashboard, Center for Systems Science and Engineering, Johns Hopkins University & Medicine, Coronavirus Resource Center, https://coronavirus.jhu.edu/map.html, accessed May 5, 2021.     6.  Walter Scheidel, “The Spanish Flu Didn’t Wreck the Global Economy,” Foreign Affairs, May

…

Osterholm and Mark Olshaker, “Chronicle of a Pandemic Foretold,” Foreign Affairs, July/August 2020, 19, https://www.foreignaffairs.com/articles/united-states/2020-05-21/coronavirus-chronicle-pandemic-foretold.   12.  Mapping the Global Future: Report of the National Intelligence Council’s 2020 Project (Washington, DC: National Intelligence Council, 2004), 9–

…

.   30.  World Health Organization, transcript, “Virtual Press Conference on COVID-19,” March 11, 2020, 14, https://www.who.int/docs/default-source/coronaviruse/transcripts/who-audio-emergencies-coronavirus-press-conference-full-and-final-11mar2020.pdf?sfvrsn=cb432bb3_2.   31.  Interview with David Fidler, March 8, 2021.   32.  Xiaolin Wei, “China’s

…

David Bandurski, “Whistling Against Deception,” China Media Project, March 11, 2020, http://chinamediaproject.org/2020/03/11/whistling-against-deception/.   43.  Whittell, “The Disappeared.”   44.  “Coronavirus: Why Have Two Reporters in Wuhan Disappeared?,” BBC, February 14, 2020, https://www.bbc.com/news/world-asia-china-51486106.   45.  Bill Bishop, “Another Standing

…

Exclusive: Internal Chinese Report Warns Beijing Faces Tiananmen-Like Global Backlash over Virus—Sources,” Reuters, May 4, 2020, https://uk.reuters.com/article/uk-health-coronavirus-china-sentiment-ex/exclusive-internal-chinese-report-warns-beijing-faces-tiananmen-like-global-backlash-over-virus-sources-idUKKBN22G198.   75.  China Global Television Network, “Zhong Nanshan

…

: With Covid, China Took a Leading Role,” Associated Press, February 15, 2021, https://apnews.com/article/pandemics-beijing-only-on-ap-epidemics-media-122b73e134b780919cc1808f3f6f16e8.   82.  “Coronavirus: China Accuses US of Spreading ‘Conspiracies,’” BBC, May 24, 2020, https://www.bbc.com/news/world-asia-china-52790634.   83.  Hua Chunying 华春莹 (@SpokespersonCHN), “#Pompeo

…

, Laura Kayali, and Laurens Cerulus, “European Commission Accuses China of Peddling Disinformation,” Politico, June 10, 2020, https://www.politico.eu/article/european-commission-disinformation-china-coronavirus/.   92.  Yang, “China’s Early Warning System.”   93.  Whittell, “The Disappeared.”   94.  Yao Yang, “Is a New Cold War Coming?,” interview with Beijing Cultural

…

_beyond_the_pandemic.   15.  Maurizio Massari, “Italian Ambassador to the EU: Italy Needs Europe’s Help,” Politico, March 10, 2020, https://www.politico.eu/article/coronavirus-italy-needs-europe-help/.   16.  Europe Elects (@EuropeElects), “Italy: Tecnè poll,” Twitter, April 11, 2020, 5:00 p.m., https://twitter.com/europeelects/status

…

,” Financial Times, April 16, 2020, https://www.ft.com/content/3ea8d790-7fd1-11ea-8fdb-7ec06edeef84.   32.  Schmitt-Roschmann, “After Glimpsing ‘Abyss’”; Rinke and Wacket, “Coronavirus Pandemic Is Historical Test”; Sánchez, “Europe’s Future Is at Stake”; Mallet and Khalaf, “FT Interview: Emmanuel Macron.”   33.  Martin Wolf, “German Court Decides to

…

Lee, “Taiwan’s New ‘Electronic Fence’ for Quarantines Leads Wave of Virus Monitoring,” Reuters, March 20, 2020, https://www.reuters.com/article/us-health-coronavirus-taiwan-surveillanc/taiwans-new-electronic-fence-for-quarantines-leads-wave-of-virus-monitoring-idUSKBN2170SK; interviews with government officials of Taiwan.   40.  “Taiwan Can Help, and

…

/; Rocky Swift, “Study Links Japan’s Domestic Travel Campaign to Increased COVID-19 Symptoms,” Reuters, December 8, 2020, https://www.reuters.com/article/health-coronavirus-japan-travel/study-links-japans-domestic-travel-campaign-to-increased-covid-19-symptoms-idUSKBN28I17C; Sho Saito, Yusuke Asai, and Nobuaki Matsunaga, “First and Second COVID

…

-3/fulltext; Bloomberg Quicktake (@Quicktake), “WATCH: Thousands of people in Brazil banged pots from their balconies in protest against President Bolsonaro’s handling of the #coronavirus pandemic,” Twitter, March 19, 2020, 10:00 p.m., https://twitter.com/QuickTake/status/1240820403435700226?s=20.   54.  Antonia Noori Farzan and Miriam Berger,

…

  77.  Vanessa Molter, “Virality Project (China): Pandemics & Propaganda,” Stanford Cyber Policy Center, March 19, 2020, https://cyber.fsi.stanford.edu/news/chinese-state-media-shapes-coronavirus-convo; Rachel Kleinfeld, “Do Authoritarian or Democratic Countries Handle Pandemics Better?,” Carnegie Endowment for International Peace, March 31, 2020, https://carnegieendowment.org/2020/03/31

…

Sawyer Crosby, and Samantha Kiernan, “Fighting a Pandemic Requires Trust,” Foreign Affairs, October 23, 2020, https://www.foreignaffairs.com/articles/united-states/2020-10-23/coronavirus-fighting-requires-trust.   80.  Migone, “The Influence of National Policy Characteristics”; “The Politics of Pandemics: Why Some Countries Respond Better Than Others,” Knowledge@Wharton, May

…

=premium&sref=bxQtWDnd.   19.  Author interview with three European Central Bank officials, February 12, 2021.   20.  Randow and Skolimowski, “Christine Lagarde’s $810 Billion Coronavirus U-Turn.”   21.  “Interview with Christine Lagarde, President of the ECB, Conducted by Matthieu Pelloli and Published on 9 April 2020,” European Central Bank, April

…

com/content/f8efe708-3c22-493b-88bd-855ec6d98522; Danica Kirka, “UK Economy Suffers Biggest Drop Since 1709,” Associated Press, February 12, 2021, https://apnews.com/article/coronavirus-pandemic-economy-4f0b6285a57c8b2929e2aceb864e7675; Prinesha Naidoo, “S. Africa Virus-Hit Economy Shrank Most in 100 Years in 2020,” Bloomberg, March 9, 2021, https://www.bloomberg.com

…

Student Enrollment Snapshot,” Institute of International Education, November 2020, https://www.iie.org/Research-and-Insights/Open-Doors/Fall-International-Enrollments-Snapshot-Reports; Peter Hurley, “Coronavirus and International Students,” Mitchell Institute at Victoria University, October 2020, https://www.vu.edu.au/sites/default/files/international-student-update-2020-mitchell-institute.pdf

…

-bangladeshs-garment-industry/a-53895339.     2.  Quoted in Rebecca Wright and Salman Saeed, “Bangladeshi Garment Workers Face Ruin as Global Brands Ditch Clothing Contracts amid Coronavirus Pandemic,” CNN Business, April 22, 2020, https://www.cnn.com/2020/04/22/business/bangladesh-garment-factories/index.html.     3.  “Dhaka, Bangladesh Population,” Population

…

Paul, “Bangladesh Shuts Down Villages After Tens of Thousands Attend Cleric’s Funeral,” Reuters, April 20, 2020, https://www.reuters.com/article/us-health-coronavirus-bangladesh/bangladesh-shuts-down-villages-after-tens-of-thousands-attend-clerics-funeral-idUSKBN2220PA.     9.  Kamran Reza Chowdhury, “COVID-19 Cases Soar in Bangladesh; Thousands Defy

…

2020.   12.  Ruma Paul, “Garment Exporter Bangladesh Faces $6 Billion Hit as Top Retailers Cancel,” Reuters, March 31, 2020, https://www.reuters.com/article/health-coronavirus-bangladesh-exports/garment-exporter-bangladesh-faces-6-billion-hit-as-top-retailers-cancel-idUKKBN21I2R9.   13.  “Helping Bangladesh Recover from COVID-19,” International Monetary Fund, June

…

11/bangladesh-to-resume-international-flights-on-june-16.   33.  COVID-19 Dashboard, Center for Systems Science and Engineering, Johns Hopkins University & Medicine, Coronavirus Resource Center, https://coronavirus.jhu.edu/map.html, accessed December 26, 2020.   34.  Shaina Ahluwalia and Anurag Maan, “South Asia Reached 10 Million COVID-19 Cases—Reuters

…

imf.org/en/Publications/WEO/%20Issues/2021/01/26/2021-world-economic-outlook-update.   98.  Claudia Viale, “Peru: Updated Assessment of the Impact of the Coronavirus Pandemic on the Extractive Sector and Resource Governance,” Natural Resource Governance Institute, December 18, 2020, https://resourcegovernance.org/analysis-tools/publications/peru-updated-assessment-impact

…

Surge Among Refugees in Middle East as Pandemic Pushes Most Vulnerable Deeper into Poverty,” Independent, September 20, 2020, https://www.independent.co.uk/independentpremium/world/coronavirus-cases-surge-among-refugees-middle-east-pandemic-pushes-most-vulnerable-deeper-poverty-b506833.html.   93.  Dempster et al., “Locked Down and Left Behind.”   94

…

Berger, “Refugee Camps Have Avoided the Worst of the Pandemic.”   96.  Quoted in Raquel Carvalho, “Rohingya Refugees in Bangladesh Struggle with Fear and Stigma amid Coronavirus,” South China Morning Post, September 13, 2020, https://www.scmp.com/week-asia/health-environment/article/3101271/rohingya-refugees-bangladesh-struggle-fear-and-stigma.   

…

, “Protesters Paralyze Bolivia over Election Delays, Threaten Escalation,” Washington Post, August 12, 2020, https://www.washingtonpost.com/world/the_americas/bolivia-protest-blockade-anez-evo-coronavirus/2020/08/11/7ffceb50-db48-11ea-809e-b8be57ba616e_story.html.   24.  Trigo, Kurmanaev, and McCann, “As Politicians Clashed, Bolivia’s Pandemic Death Rate Soared.”   

…

deploys-drones-cameras-loudhailers-chastise-people/story?id=68746989; Yujing Liu, “China Adapts Surveying, Mapping, Delivery Drones to Enforce World’s Biggest Quarantine and Contain Coronavirus Outbreak,” South China Morning Post, March 5, 2020, https://www.scmp.com/business/china-business/article/3064986/china-adapts-surveying-mapping-delivery-drones-task.   

…

Enforce the Country’s Lockdown After the Mayor Worried Residents Weren’t Taking Containment Measures Seriously,” Business Insider, March 20, 2020, https://www.businessinsider.com/coronavirus-drones-france-covid-19-epidemic-pandemic-outbreak-virus-containment-2020-3; Helene Fouquet and Gaspard Sebag, “French Covid-19 Drones Grounded After Privacy Complaint,” Bloomberg

…

.wsj.com/articles/beijing-ousts-four-opposition-lawmakers-in-hong-kong-11605080352; Repucci and Slipowitz, Democracy Under Lockdown, 10.   57.  Faiola, Wessel, and Mahtani, “Coronavirus Chills Protests”; Chenoweth et al., “The Global Pandemic Has Spawned New Forms of Activism—and They’re Flourishing.”   58.  Charis McGowan, “How Quarantined Chileans Are

…

-and-economic-trends-in-urban-suburban-and-rural-communities/; Elise Gould and Valerie Wilson, “Black Workers Face Two of the Most Lethal Preexisting Conditions for Coronavirus—Racism and Economic Inequality,” Economic Policy Institute, 2020, https://www.epi.org/publication/black-workers-covid/; Emily Benfer and Lindsay Wiley, “Health Justice Strategies

…

; Brenda Goodman, “Where Do COVID Vaccines Stand Against the Variants?,” Medscape, March 29, 2021, https://www.medscape.com/viewarticle/948335.     8.  Corum and Zimmer, “Coronavirus Variants and Mutations.”     9.  “Total Confirmed Cases of COVID-19,” Our World in Data, accessed February 17, 2021, https://ourworldindata.org/grapher/cumulative-covid-cases

…

Mid-June,” Politico, May 13, 2020, https://www.politico.eu/article/germany-eases-border-checks-but-some-restrictions-will-remain-until-mid-june-coronavirus-covid19/.   14.  European Commission, “Coronavirus: Commission Recommends Partial and Gradual Lifting of Travel Restrictions to the EU After 30 June, Based on Common Coordinated Approach,” press release,

…

-security-financing/.   61.  Jillian Deutsch and Sarah Wheaton, “How Europe Fell Behind on Vaccines,” Politico, January 27, 2021, https://www.politico.eu/article/europe-coronavirus-vaccine-struggle-pfizer-biontech-astrazeneca/.   62.  Deutsch and Wheaton, “How Europe Fell Behind on Vaccines”; Jacob Funk Kirkegaard, “The European Union’s Troubled COVID-19

…

to Limit Vaccine Exports.”   72.  Rym Momtaz, “Macron: AstraZeneca Vaccine Seems ‘Quasi-Ineffective’ on Older People,” Politico, January 29, 2021, https://www.politico.eu/article/coronavirus-vaccine-europe-astrazeneca-macron-quasi-ineffective-older-pe/.   73.  European Medicines Agency, “EMA Recommends COVID-19 Vaccine AstraZeneca for Authorisation in the EU,” January 29

…

, 2020, https://www.washingtonpost.com/world/vaccine-russia-china-influence/2020/11/23/b93daaca-25e5-11eb-9c4a-0dc6242c4814_story.html; Mark Scott, “In Race for Coronavirus Vaccine, Russia Turns to Disinformation,” Politico, November 19, 2020, https://www.politico.eu/article/covid-vaccine-disinformation-russia/; Lili Bayer and Jillian Deutsch, “Hungary

…

March 27, 2021, https://www.nytimes.com/2021/03/27/world/americas/virus-brazil-bolsonaro.html.   89.  Quoted in Mauricio Savarese, “Brazil’s Bolsonaro Rejects Coronavirus Vaccine from China,” AP News, October 21, 2020, https://apnews.com/article/virus-outbreak-brazil-state-governments-health-sao-paulo-b7b5b620ba54f402dbf803e26fe6b842.   90.  Antonia Noori Farzan

…

and Heloísa Traiano, “U.S. Officials Pushed Brazil to Reject Russia’s Coronavirus Vaccine, According to HHS report,” Washington Post, March 16, 2021, https://www.washingtonpost.com/world/2021/03/16/hhs-brazil-sputnik-russia/.   91.  Eduardo

…

Macaya, Melissa Mathani, and Fernando Alfonso III, “October 2: Trump’s Covid Diagnosis,” CNN, October 2, 2020, https://www.cnn.com/politics/live-news/trump-coronavirus-positive/h_cebb891fe9fe8513948709d5f1793e07.   95.  Jeff Mason and Joseph Ax, “Chaotic Clash in Cleveland: Five Takeaways from First U.S. Presidential Debate,” Reuters, September 29,

…

-international-health-architecture; “U.S., China Positive on Pandemic Treaty Idea: WHO’s Tedros,” Reuters, March 30, 2021, https://www.reuters.com/article/us-health-coronavirus-treaty-members-idUSKBN2BM10T.   35.  Burwell et al., “Improving Pandemic Preparedness: Lessons from COVID-19,” 78–79, 89–92.   36.  World Health Organization, “International Health

…

Adhanom Ghebreyesus third wave (of autocratization) Tillerson, Rex Tooze, Adam Troye, Olivia Trump, Donald “America First” platform Bolsonaro, Jair, and cancellation of 2020 G7 summit Coronavirus Task Force COVID-19 response COVID-19 vaccine development and on “deep state” downplaying of COVID-19 Helsinki summit Johnson, Boris, and Macron, Emmanuel, and

Uncontrolled Spread: Why COVID-19 Crushed Us and How We Can Defeat the Next Pandemic

by Scott Gottlieb  · 20 Sep 2021

rudimentary surveillance effort. In the absence of surveillance testing, health officials were forced to rely largely on a far less sensitive tool to tell whether coronavirus was starting to spread in local communities: syndromic surveillance. This approach relies on dozens of different streams of information on things such as how

…

in the Morbidity and Mortality Weekly Report, were often thorough, data driven, well researched, and late. The agency issued recommendations on the risk of coronavirus transmission through touching contaminated surfaces (fomites), measures to improve safety in schools, the role of respiratory aerosols and droplets, and countless other aspects of COVID

…

these sorts of countermeasures. In 2015, the head of BARDA, Robin Robinson, told the publication BioCentury that his agency didn’t have funding to develop coronavirus countermeasures. “We are funded for pandemic influenza and man-made threats like anthrax, smallpox, nuclear devices and chemical agents. If we had another emergency

…

drug makers, including Sanofi and Novavax, for their COVID vaccines. By the fall of 2020, nearly seventy different experimental vaccines used segments of the coronavirus spike protein as a way to try to generate immunity. Most used recombinant technology, where the proteins are derived from synthetic genomic material manufactured in

…

Schniming, “Wuhan nCoV Outbreak Quadruples, Spreads within China,” CIDRAP News, January 19, 2020. 3.Walter Sim, “Japan Confirms First Case of Infection from Wuhan Coronavirus; Vietnam Quarantines Two Tourists,” Straits Times, January 17, 2020. 4.World Health Organization (@WHO), “Preliminary Investigations Conducted by the Chinese Authorities Have Found No Clear

…

March 3, 2020. 11.Ibid. 12.Amos Zeeberg, “Piecing Together the Next Pandemic,” New York Times, February 16, 2021; and Ellen C. Carbo et al., “Coronavirus Discovery by Metagenomic Sequencing: A Tool for Pandemic Preparedness,” Journal of Clinical Virology 131, (2020): 104594. 13.Michael T. Osterholm and Mark Olshaker, Deadliest Enemy

…

Muzzled Her for Sharing Report on WeChat,” South China Morning Post, March 11, 2020. 23.Reporters Without Borders, “Whistleblowing Doctor Missing After Criticizing Beijing’s Coronavirus Censorship,” April 14, 2020. 24.Jianxing Tan, “新冠肺炎"吹哨人"李文亮：真相最重要” [“Covid-19 “Whistleblower” Li Wenliang: the Truth is Most Important”], Caixin, January 31, 2020. 25.Lin Zehong,

…

,” January 30, 2020. 50.Heritage Institute, “Virtual Event: One Year Later: Lessons from the Early COVID-19 Response,” January 14, 2021. 51.Cohen, “Mining Coronavirus Genomes for Clues to the Outbreak’s Origins.” 52.World Health Organization, “Pandemic Influenza Preparedness Framework,” May 24, 2011. 53.Emily Baumgaertner, “China Has Withheld

…

Mistakes),” New York Times, January 14, 2021. 68.Nicholas A. Christakis, Apollo’s Arrow (New York: Little, Brown Spark, 2020); and Keng Jin Lee, “Coronavirus Kills Chinese Whistleblower Ophthalmologist,” American Academy of Ophthalmology, February 10, 2020. 69.People’s Daily, “Why Wuhan Central Hospital Has the Highest Rate of Medical

…

Emergency of International Concern,’” April 29, 2009. 72.Xinhua News Agency, “Xi Jinping Made Important Instructions on the Pneumonia Epidemic Caused by the New Coronavirus, Emphasizing That the Safety and Health of the People Should Be Put First, Resolutely Curbing the Spread of the Epidemic, Li Keqiang Issued Instructions,” January

…

for Disease Control and Prevention, “Interim Guidance on Duration of Isolation and Precautions for Adults with COVID-19,” February 13, 2021, https://www.cdc.gov/coronavirus/2019-ncov/hcp/duration-isolation.html. 23.Shatavia S. Morrison, “COVID-19 Genomic Epidemiology Toolkit: Module 1.2,” US Centers for Disease Control and

…

between Analytical Sensitivity and Detection Limit,” American Journal of Clinical Pathology 107, no. 5 (1997): 619. 26.Amy Maxmen, “The Race to Unravel the Biggest Coronavirus Outbreak in the United States,” Nature, March 7, 2020. 27.Fink and Baker, “‘It’s Just Everywhere Already.’” 28.Matt Markovich, “Seattle Flu Study

…

manufactured by Luminex and BioFire. Among the viruses that the BioFire panel can screen for using a single test are Adenovirus, Coronavirus HKU1, Coronavirus NL63, Coronavirus 229E, Coronavirus OC43, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), Human Metapneumovirus, Human Rhinovirus/Enterovirus, Influenza A, Influenza A/H1, Influenza A/H3, Influenza A/H1

…

, Nightmare Scenario: Inside the Trump administration’s Response to the Pandemic That Changed History (New York: HarperCollins, 2021). 17.Brett Murphy and Letitia Stein, “Coronavirus Response Delayed Despite Health Officials’ Private Alarm,” USA Today, January 26, 2021. On February 29, CDC director Robert Redfield said at a White House press

…

Transmitted Pathogen,” Current Opinion in Infectious Diseases 31, no. 1 (2018): 39–44. 21.David William, “Lessons Unlearned: Four Years before the CDC Fumbled Coronavirus Testing, the Agency Made Some of the Same Mistakes with Zika,” Washington Post, July 4, 2020. 22.US Centers for Disease Control and Prevention, “Trioplex

…

, “Response to Investigative Team Explanation.” Chapter 7: The CDC Fails 1.US Food and Drug Administration, “Accelerated Emergency Use Authorization (EUA) Summary ORIG3N 2019 Novel Coronavirus (COVID-19) Test (ORIG3N, INC.),” April 4, 2020, https://www.fda.gov/media/136873/download; and Ruth McBride, Marjorie van Zyl, and Burtram Fielding,

…

reporter, “Integrated DNA Technologies Authorized under CDC EUA to Provide SARS-CoV-2 Test Kits,” Genome Web, March 3, 2020. 18.David Willman, “CDC Coronavirus Test Kits Were Likely Contaminated, Federal Review Confirms,” Washington Post, June 20, 2020. 19.Alexander Borst et al., “False-Positive Results and Contamination in Nucleic

…

of the Immediate Office of the General Counsel’s Investigation Regarding CDC’s Production of COVID-19 Test Kits.” 27.Ibid; and Willman, “CDC Coronavirus Test Kits Were Likely Contaminated, Federal Review Confirms.” 28.The CDC ultimately made the virus available to test manufacturers through BEI Resources, a quasi-governmental

…

Human Services press release, January 31, 2020, https://www.hhs.gov/about/news/2020/01/31/secretary-azar-declares-public-health-emergency-us-2019-novel-coronavirus.html; and US Food and Drug Administration, “Determination of a Public Health Emergency and Declaration that Circumstances Exist Justifying Authorizations Pursuant to Section 564(

…

and Human Services, “Rescission of Guidances and Other Informal Issuances Concerning Premarket Review of Laboratory Developed Tests,” August 19, 2020, https://www.hhs.gov/coronavirus/testing/recission-guidances-informal-issuances-premarket-review-lab-tests/index.html. 34.Kathleen McLaughlin, “HHS Relaxed Oversight of Problematic Covid-19 Tests Despite Being Told

…

2020, https://www.washingtonpost.com/context/letter-from-aphl-to-fda-commissioner-stephen-hahn/547133a7-6e13-4995-b14d-c3e0748e90b8/; and Boburg et al., “Inside the Coronavirus Testing Failure.” 36.Scott Gottlieb (@ScottGottliebMD), “THREAD ON DIAGNOSTICS: In recent public health emergencies there’s been a stepwise approach to ramp up U.S

…

With this data, the state would be able to seek authorization to do their own testing using New York State’s laboratory developed test. 48.“Coronavirus (COVID-19) Update: FDA Provides More Regulatory Relief During Outbreak, Continues to Help Expedite Availability of Diagnostics,” US Food and Drug Administration press release,

…

March 16, 2020, https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-provides-more-regulatory-relief-during-outbreak-continues-help. 49.Caroline Chen, Marshall Allen, and Lexi Churchill, “Internal Emails Show How Chaos

…

-19 should be evaluated among potentially exposed healthcare personnel.” See US Centers for Disease Control and Prevention, “Updated Guidance on Evaluating and Testing Persons for Coronavirus Disease 2019 (COVID-19),” March 8, 2020. 57.The CDC ultimately made the virus available to test manufacturers through BEI Resources. The University of

…

of a virus. See US Food and Drug Administration, “EUA Authorized Serology Test Performance,” accessed February 26, 2021, https://www.fda.gov/medical-devices/coronavirus-disease-2019-covid-19-emergency-use-authorizations-medical-devices/eua-authorized-serology-test-performance. 5.“Abbott’s Fast, $5, 15-Minute, Easy-to-Use COVID

…

Skilled Nursing News, July 31, 2020. 19.Ritter and Metz, “Nevada Reverses Ban on Rapid Tests after Federal Pushback.” 20.US Food and Drug Administration, “Coronavirus (COVID-19) Update: FDA Takes Steps to Streamline Path for COVID-19 Screening Tools, Provides Information to Help Groups Establishing Testing Programs,” March 16, 2021

…

, https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-takes-steps-streamline-path-covid-19-screening-tools-provides. 21.“Trump Interrupts Health Officials: ‘Anybody That Wants a Test Can Get

…

Update: White House Press Briefing by FDA Commissioner Stephen M. Hahn, M.D.,” March 7, 2020, https://www.fda.gov/news-events/speeches-fda-officials/coronavirus-covid-19-update-white-house-press-briefing-fda-commissioner-stephen-m-hahn-md-03072020. 24.COVID-19 Test Capacity (@COVID2019tests), Twitter, https://twitter.com/COVID2019tests

…

-statewide-shutdown-restaurants-bars-and-limits-size-gatherings-expanded. 31.Weizhen Tan and Riya Bhattacharjee, “California Governor Issues Statewide Order to ‘Stay at Home’ as Coronavirus Cases Soar,” CNBC, March 20, 2020. Chapter 9: Shortage after Shortage 1.WECT Staff, “CDC Recommends Healthcare Providers Assume Those with Mild Symptoms to

…

/news/governors-of-six-states-announce-major-bipartisan-compact-for-three-million-rapid-antigen-tests/. 39.Erin Cox, “There’s No National Testing Strategy for Coronavirus. These States Banded Together to Make One.,” Washington Post, August 4, 2020. 40.Scott Gottlieb, “The States Are Laboratories for Covid Control,” Wall Street

…

Social Activity in Virus Fight, Warns of Recession,” Reuters, March 16, 2020. 15.Benjamin Siegel, “How Anesthesia Machines Can Help Hospitals with Ventilator Shortages Fight Coronavirus,” ABC News, March 27, 2020; and Kathleen Moore, “Local Anesthesiologists Converting Machines to Ventilators,” Post Star, March 26, 2020. 16.Jessie Yeung et al.,

…

on smallpox eradication would never have started—selecting the target helped develop the appropriate tools and strategy.” 21.Amanda Watts, “Health Official’s Advice on Coronavirus Response: ‘Speed Trumps Perfection,’” CNN, March 13, 2020. 22.James Glanz and Campbell Robertson, “Lockdown Delays Cost at Least 36,000 Lives, Data Show,”

…

/questions-answers/questions-answers-prevention. 41.Alvin Powell, “Is Air Conditioning Helping Spread COVID in the South?,” Harvard Gazette, June 29, 2020; Christopher Flavelle, “Coronavirus Makes Cooling Centers Risky, Just as Scorching Weather Hits,” New York Times, May 6, 2020; and Jianyun Lu et al., “COVID-19 Outbreak Associated with

…

for Disease Control and Prevention, “Discontinuation of Isolation for Persons with COVID-19 Not in Healthcare Settings,” February 18, 2021, https://www.cdc.gov/coronavirus/2019-ncov/hcp/disposition-in-home-patients.html. 8.Julia C. Pringle et al., “COVID-19 in a Correctional Facility Employee Following Multiple Brief Exposures

…

Situational Awareness Network Capabilities,” September 2017; and Yuval Levin, “Biden’s Pandemic-Policy Challenge,” National Review, January 18, 2021. 32.Melissa Healy, “California’s Coronavirus Strain Looks Increasingly Dangerous: ‘The Devil Is Already Here,’” Los Angeles Times, February 23, 2021. 33.Public Health England, “SARS-CoV-2 Variants of Concern

…

and Epidemiology of Middle East Respiratory Syndrome Corona Virus,” Multidisciplinary Respiratory Medicine 12, no. 20 (2017). 5.World Health Organization, “Middle East Respiratory Syndrome Coronavirus (MERS-CoV)—Saudi Arabia,” December 4, 2015, https://www.who.int/csr/don/4-december-2015-mers-saudi-arabia/en/. 6.Al-Osail and Al

…

Light on Chaotic COVID Decision-Making during Trump Administration,” Biocentury, May 14, 2021. 29.Tina Nguyen, “How a Chance Twitter Thread Launched Trump’s Favorite Coronavirus Drug,” Politico, April 7, 2020. 30.Kevin Roose and Matthew Rosenberg, “Touting Virus Cure, ‘Simple Country Doctor’ Becomes a Right-Wing Star,” New

…

Bloomberg, April 20, 2020. 26.Stacy Lawrence, “Regeneron, BARDA Partner to Develop MERS Virus Treatment,” Fierce Biotech, August 22, 2016; and “Antibody Treatment for MERS Coronavirus Safe in People,” US National Institutes of Health press release, March 2, 2021. 27.George D. Yancopoulos, cofounder, president, and chief scientific officer of Regeneron

…

Gottlieb and Mark McClellan, “The Trump Treatment for Covid Is Coming Soon,” Wall Street Journal, October 8, 2020. 35.CBS News, “Transcript: Scott Gottlieb Discusses Coronavirus on ‘Face the Nation,’ October 11, 2020,” October 11, 2020. 36.Scott Gottlieb, “Antibodies as Covid Insurance,” Wall Street Journal, December 13, 2020. 37

…

and New Vaccine Variants,” Pfizer press release, February 25, 2021. 39.Kevin O. Saunders et al., “Neutralizing Antibody Vaccine for Pandemic and Pre-emergent Coronaviruses,” Nature (2021). Chapter 18: A New Doctrine for National Security 1.“There is no recent precedent for treating disease as a security threat. So unfamiliar

…

Cases,” Clinical Infectious Diseases 42, no. 5 (2006): 634–9. 9.Patrick C. Y. Woo et al., “Characterization and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia,” Journal of Virology 79, no. 2 (2004): 884–95. 10.Xinhua, “21 Doctors, Nurses Infected with Pneumonia in E

…

investigators needed to safely operate this high-containment laboratory.” See Josh Rogin, “Opinion: State Department Cables Warned of Safety Issues at Wuhan Lab Studying Bat Coronaviruses,” Washington Post, April 14, 2020. 46.US Department of State, “Fact Sheet: Activity at the Wuhan Institute of Virology.” 47.Bryan A. Johnson, Xuping

…

Uncover COVID-19’s Origins.” 60.US National Institutes of Allergy and Infectious Diseases of the National Institutes of Health, “Understanding the Risk of Bat Coronavirus Emergence,” 2014–19, https://reporter.nih.gov/search/xQW6UJmWfUuOV01ntGvLwQ/project-details/9491676; and Peter Daszak and Vincent Racaniello, “This Week in Virology 615: Peter

…

173 National Academy of Medicine, 386–87 National Academy of Science’s Institute of Medicine, 342–43 National Aeronautics and Space Administration (NASA), 8 “National Coronavirus Response: A Road Map to Reopening” (AEI report), 250–52 National Human Genome Research Institute, 373 National Institute of Allergy and Infectious Diseases (NIAID),

How to Talk to a Science Denier: Conversations With Flat Earthers, Climate Deniers, and Others Who Defy Reason

by Lee McIntyre  · 14 Sep 2021  · 407pp  · 108,030 words

Change 5    Canary in the Coal Mine 6    Genetically Modified Organisms: Is There Such a Thing as Liberal Science Denial? 7    Talking with Trust 8    Coronavirus and the Road Ahead Epilogue Acknowledgments Bibliography Index List of Figures Figure 2.1 Fabricated data used as stimuli in an experiment by Kahan et

…

—Flat Earth—but set the foundation for recognizing them in the other examples of science denialism that we will encounter later: climate change, GMOs, and coronavirus. As stated, our goal here is to show that all science denial uses a common pattern. Later, we will explore why. Cherry-Picking If

…

makes us think we will have the political will to do so for climate change? 3.  If special interests can so quickly politicize something like coronavirus—by using the most ridiculous conspiracy theories and partisan nonsense—what hope do we have to unpolarize the “debate” about climate change?25 This is

…

for global warming too.26 And, in a weird confluence of events, there is some unabashedly good news for the climate that is linked to coronavirus. During the first few weeks of the pandemic, global emissions plunged an unprecedented 17 percent in early April 2020. According to a United Nations report

…

notice the obvious similarities here. Indeed, since all science denial is basically the same, it is notable that the type of denial we find for coronavirus is eerily similar to that for climate change and other issues. Misinformation, wishful thinking, blame, denial, and making up facts, followed by the claim

…

Science Has Delayed the Response to COVID-19 (and Climate Change),” Inside Climate News, March 19, 2020, https://insideclimatenews.org/news/19032020/denial-climate-change-coronavirus-donald-trump?gclid=EAIaIQobChMIsan_qduf6gIVDo3ICh1XPAIuEAAYASAAEgID0_D_BwE; Gilad Edelman, “The Analogy between COVID-19 and Climate Change Is Eerily Precise,” Wired, March 25, 2020, https

…

the Economy? How about Offering Testing and Basic Protections?” Washington Post, April 18, 2020, https://www.washingtonpost.com/sports/2020/04/18/sally-jenkins-trump-coronavirus-testing-economy/. 31. Indeed, a poll taken just after the 2016 presidential election showed that 62 percent of Trump voters supported carbon pollution taxes! If

…

and squarely in the wheelhouse of any book on science denial. But the politics of anti-vaxx are dauntingly equivocal, especially in the age of coronavirus.29 And, as previously noted, this topic has been covered quite extensively in recent years, and there are several excellent books already available. Seth Mnookin

…

it’s tempting in these post-truth times—when we see serious discussions about facts, proof, evidence, and lying about the economy, environment, immigration, crime, coronavirus, and a host of other topics on our TV news every day—to conclude that the only explanation for disbelief and denial is one’s

…

parallels between the rejection of truth in general (about the number of people at Trump’s inauguration, whether Greenland is for sale, or whether the coronavirus will someday “disappear like a miracle”) and the specific issue of science denial. In my book Post-Truth, I argued that one of the most

…

States and other Western democracies.31 Surely one’s beliefs about any scientific topic can be politicized—as we are seeing right now with the coronavirus. Even if they are not inherently political to begin with—or don’t tread on some preexisting ideological belief about free markets or individual freedom

…

been spreading science denial propaganda since the AIDS crisis in the 1980s, up through Ebola, until today with numerous conspiracies about the cause of the coronavirus. William J. Broad, “Putin’s Long War Against American Science,” New York Times, April 13, 2020, https://www.nytimes.com/2020/04/13/science/

…

putin-russia-disinformation-health-coronavirus.html; Julian E. Barnes and David E. Sanger, “Russian Intelligence Agencies Push Disinformation on Pandemic,” New York Times, July 28, 2020, https://www.nytimes.com

…

kill. Especially when in the hands of a national government, denialist beliefs are unusually deadly. Indeed, this is exactly what we are seeing today with coronavirus in the United States.2 The COVID-19 pandemic is the latest example of science denial. It grew from nothing at the beginning of 2020

…

every day. The emphasis and character of denialist claims may change from day to day, but the overall effect is obvious. President Trump is a coronavirus denier, and he has infected millions of his followers with denialist beliefs. Cherry-Picking “It’s just like the flu.” “Most people recover.” “This

…

recently, Trump praised the work of Dr. Stella Immanuel as “very impressive” and “spectacular” for her claim that hydroxychloroquine is a potential treatment for the coronavirus and her belief that masks are unnecessary.8 Further investigation revealed that Dr. Immanuel’s other medical opinions include the idea that “gynecological problems like

…

discredited anti-vaxx hesitancy concerns seem credible. In spring 2020, an AP poll showed that only 50 percent of Americans said they would take the coronavirus vaccine if it were available.19 The numbers were worse for Republicans, where only 43 percent said they would get the vaccine (whereas 62 percent

…

that the same is true of COVID-19?28 According to researchers at Carnegie Mellon University, nearly half of the Twitter accounts spreading misinformation about coronavirus are likely bots. Approximately 82 percent of the fifty most influential retweeters on ending the lockdowns and various COVID-19 conspiracies have been bots.29

…

of course bear some responsibility for the spread of disinformation about COVID-19. Not only are they the preferred platform for foreign propaganda about the coronavirus, they have been responsible for spreading denialist misinformation about other scientific topics for years. According to one February 2020 study out of Brown University, 25

…

subject of conversation was misleading political ads (which he decided to allow).35 By the time of the pandemic—at least for misinformation about the coronavirus—Zuckerberg changed his tune. Amid charges that most COVID-19 misinformation had originated on Facebook, the company responded by pointing out that it had removed

…

misinformation,” including content that could “lead to imminent harm including posts about false cures, claims that social distancing measures do not work and 5G causes coronavirus.”36 On August 5, 2020, Facebook even removed a post from the Trump campaign that included a clip of Trump falsely claiming that children were

…

will inevitably cause harm. Perhaps the pandemic will open the door to more of these efforts, on other denialist topics, in the future. Lessons from Coronavirus: Unify and Conquer One of the most fascinating aspects of the COVID-19 pandemic has been the chance to see what a denialist campaign looks

…

how to fight science denial in general. Many have noted, for instance, the startling parallels between COVID-19 denial and climate denial.41 In the coronavirus pandemic, we have a microcosm of the threat from global warming: it is an existential threat to the entire planet that portends fairly drastic economic

…

research shows that even deniers—and, notably, especially conservative ones—can be compelled by scientific consensus.50 The work cited here was done before the coronavirus pandemic, and mostly involved the acceptance of consensus on climate change, but there is no reason to think that this would not also apply to

…

other COVID-19 deniers to change their beliefs or behaviors, especially in an atmosphere of distrust. This is particularly true on an issue like the coronavirus, where knowledge is evolving rapidly. Warzel starts with an analogy about the Ebola virus crisis. He writes: As the Ebola epidemic raged in 2014,

…

in turn built trust—and as a result that trust was returned. Contrast this with the situation involving anti-maskers and other deniers around the coronavirus pandemic in the US. The political division and partisan context seems intractable, but is it? As Warzel points out, most people—even Republicans—still

…

26, 2008, https://www.theguardian.com/world/2008/nov/26/aids-south-africa. 2. Epidemiologists have estimated that approximately 90 percent of American deaths from coronavirus were due to the Trump administration’s delay between March 2 and March 16. Eugene Jarecki, “Trump’s Covid-19 Inaction Killed Americans. Here’s

…

“Burning Cell Towers, Out of Baseless Fear They Spread the Virus,” New York Times, April 10, 2020, https://www.nytimes.com/2020/04/10/technology/coronavirus-5g-uk.html; Travis M. Andrews, “Why Dangerous Conspiracy Theories about the Virus Spread So Fast—and How They Can Be Stopped,” Washington Post, May

…

1, 2020, https://www.washingtonpost.com/technology/2020/05/01/5g-conspiracy-theory-coronavirus-misinformation/. 5. Matthew Rozsa, “We Asked Experts to Respond to the Most Common COVID-19 Conspiracy Theories and Misinformation,” Salon, July 18, 2020, https://www

…

about Light as Remedy, but Also Disinfectant, Which Is Dangerous,” New York Times, April 24, 2020, https://www.nytimes.com/2020/04/24/health/sunlight-coronavirus-trump.html. 7. Mayla Gabriela Silva Borba et al., “Chloroquine Diphosphate in Two Different Dosages As Adjunctive Therapy of Hospitalized Patients with Severe Respiratory Syndrome

…

in the Context of Coronavirus (SARS-CoV-2) infection: Preliminary Safety Results of a Randomized, Double-Blinded, Phase IIb Clinical Trial (CloroCovid-19 Study),” medRxiv (preprint), April 7, 2020, https

…

, “Small Chloroquine Study Halted over Risk of Fatal Heart Complications,” New York Times, April 12, 2020, https://www.nytimes.com/2020/04/12/health/chloroquine-coronavirus-trump.html; Elyse Samuels and Meg Kelly, “How False Hope Spread about Hydroxychloroquine to Treat COVID-19—and the Consequences That Followed,” Washington Post, April

…

-19-drug-they-spent-weeks-promoting/2020/04/22/eeaf90c2-84ac-11ea-ae26-989cfce1c7c7_story.html. 8. Dickens Olewe, “Stella Immanuel—the Doctor behind Unproven Coronavirus Cure Claim,” BBC News, July 29, 2020, https://www.bbc.com/news/world-africa-53579773. 9. Margaret Sullivan, “This Was the Week America Lost

…

10. Stephen Collinson, “Trump Seeks a ‘Miracle’ as Virus Fears Mount,” CNN, February 28, 2020, https://www.cnn.com/2020/02/28/politics/donald-trump-coronavirus-miracle-stock-markets/index.html. 11. Consider this analogy: if we were catching more fish only because we were putting out twice as many nets

…

the hosts of popular Fox News shows were doing that. Margaret Sullivan, “The Data Is In: Fox News May Have Kept Millions from Taking the Coronavirus Threat Seriously,” Washington Post, June 28, 2020, https://www.washingtonpost.com/lifestyle/media/the-data-is-in-fox-news-may-have-kept-millions-from-taking

…

-the-coronavirus-threat-seriously/2020/06/26/60d88aa2-b7c3-11ea-a8da-693df3d7674a_story.html. An even more fine-grained analysis has revealed that there was a correlation

…

-Burroughs, “Antivaccination Activists Are Growing Force at Virus Protests,” New York Times, May 2, 2020, https://www.nytimes.com/2020/05/02/us/anti-vaxxers-coronavirus-protests.html. 16. Liz Szabo, “The Anti-vaccine and Anti-lockdown Movements Are Converging, Refusing to Be ‘Enslaved,’” Los Angeles Times, April 24, 2020, https

…

Group’s Links to America’s Far Right,” Guardian, May 8, 2020, https://www.theguardian.com/world/2020/may/08/lockdown-groups-far-right-links-coronavirus-protests-american-revolution. 23. Chuck Todd et al., “The Gender Gap between Trump and Biden Has Turned into a Gender Canyon,” NBC News, June

…

Enforcing Mask Rules? Often Retail Workers, and They’re Getting Hurt,” New York Times, May 15, 2020, https://www.nytimes.com/2020/05/15/us/coronavirus-masks-violence.html; Bill Hutchinson, “‘Incomprehensible’: Confrontations over Masks Erupt amid COVID-19 Crisis,” ABC News, May 7, 2020, https://abcnews.go.com/US/incomprehensible

…

Messages That Sowed Virus Panic in U.S., Officials Say,” New York Times, April 22, 2020, https://www.nytimes.com/2020/04/22/us/politics/coronavirus-china-disinformation.html. 32. Oliver Milman, “Revealed: Quarter of All Tweets about Climate Crisis Produced by Bots,” Guardian, February 21, 2020, https://www.theguardian.com

…

, August 4, 2020, https://www.nbcnews.com/think/opinion/did-trump-kushner-ignore-blue-state-covid-19-testing-deaths-ncna1235707. 48. Bill Barrow et al., “Coronavirus’ Spread in GOP Territory, Explained in Six Charts,” AP News, June 30, 2020, https://apnews.com/7aa2fcf7955333834e01a7f9217c77d2. 49. Lewandowsky and Oberauer, “Motivated Rejection of Science

…

s Tulsa Rally, Oklahoma Reports Record High COVID-19 Numbers,” Time, July 11, 2020, https://time.com/5865890/oklahoma-covid-19-trump-tulsa-rally/. 52. “Coronavirus: Donald Trump Wears Face Mask for the First Time,” BBC, July 12, 2020, https://www.bbc.com/news/world-us-canada-53378439. 53. John Wagner

…

‘a Fake Crisis.’ Then He Contracted It and Changed His Mind,” NBC News, May 18, 2020, https://www.nbcnews.com/news/us-news/he-thought-coronavirus-was-fake-crisis-then-he-contracted-it-n1209246. 56. Kim LaCapria, “Richard Rose Dies of COVID-19, After Repeated ‘Covid Denier’ Posts,” Truth or

…

html. 58. Charlie Warzel, “How to Actually Talk to Anti-Maskers,” New York Times, July 22, 2020, https://www.nytimes.com/2020/07/22/opinion/coronavirus-health-experts.html. 59. Warzel, “How to Actually Talk to Anti-Maskers.” 60. He cites a June 2020, New York Times/Siena College survey that

…

path of a hurricane, to whether California forest fires could be prevented by more raking, and whether bleach and light were potential treatments for the coronavirus and masks a good preventative measure during a pandemic. But we should also remember that, as we saw in chapter 6, science denial is not

…

is out of office, the ideological rejection of science is entrenched in other countries, which have their own problems. Anti-vaxx is rampant in Italy. Coronavirus conspiracy theories led to the toppling of 5G cell towers in England. Flat Earthers make up a nonnegligible portion of the national population in Brazil

…

-0631-5. Warzel, Charlie. “How to Actually Talk to Anti-Maskers.” New York Times, July 22, 2020. https://www.nytimes.com/2020/07/22/opinion/coronavirus-health-experts.html. West, Mick. Escaping the Rabbit Hole: How to Debunk Conspiracy Theories Using Facts, Logic, and Respect. New York: Skyhorse, 2018. Wood,

A Shot to Save the World: The Inside Story of the Life-Or-Death Race for a COVID-19 Vaccine

by Gregory Zuckerman  · 25 Oct 2021  · 368pp  · 106,185 words

revolutionary, helped found Moderna Jason Mclellan—Structural biologist, discovered way to keep spike protein in ideal form Nianshuang Wang—Native of China, worked on breakthrough coronavirus research Government Scientists Anthony Fauci—Top U.S. infectious-disease expert Barney Graham—Deputy director, Vaccine Research Center; chased RSV vaccines, worked with Moderna on

…

, he’d use his insect system to try to develop other vaccines. Eventually, he’d focus on a very different kind of pathogen: a new coronavirus. 3 1996–2008 Mice lie, monkeys mislead, and ferrets are weasels. —a popular aphorism among scientists The phone rang in John Shiver’s office,

…

a vaccine technology to defend against malaria, influenza, and many other viruses and diseases. Eventually, they’d even use it to take on a novel coronavirus. * * * • • • Dan Barouch was sure he could avoid Merck’s mistake. Barouch was a thirty-one-year-old scientist in 2004, running a small research

…

lowest point,” says McLellan. McLellan called Graham for advice. In his soothing tone, Graham suggested that McLellan focus on a different type of pathogen: coronaviruses. These viruses didn’t usually grab the attention of the public, nor did most scientists care too much about them, but they are ancestrally related

…

responsible for little more than cause the common cold. Specialists in the field didn’t mind that no one cared about the area. To them, coronaviruses were unusual and interesting pathogens that expressed their genes and proteins in unique ways, satisfying the researchers’ intellectual curiosity. For some, the relative obscurity of

…

memorable for the socializing and delicious food and wine served as for the captivating presentations delivered. By then, a view had emerged that the human coronavirus, called OC43, likely arose in the nineteenth century, perhaps jumping from cows to humans before melting into civilization’s background as one of the causes

…

pathogens and for saying that colds need to run their course. But I reply with frank chagrin “Why must the blasted thing BEGIN?”8 Eventually, coronavirus vaccines were introduced for some livestock, protecting their vulnerable respiratory and gastrointestinal systems from the virus, but most scoffed at the notion of focusing precious

…

disease it caused was called SARS, short for severe acute respiratory syndrome. Soon it was killing people, reaching a mortality rate of 10 percent. Coronavirus-obsessives were absolutely stunned. They had no idea that a version of the pathogen they were so passionate about could kill humans. Suddenly, their field

…

Soon a global health crisis was under way, as the virus causing the disease, MERS-CoV, spread to dozens of countries, sparking renewed interest in coronaviruses that eventually helped McLellan receive the funding he needed for his growing Dartmouth lab. McLellan and Graham began focusing on a vaccine for MERS, helped

…

competing academic groups to the finish line, his first huge scientific achievement. Wang, who had a full face and spikey dark hair, was convinced coronaviruses would continue to threaten global health, and he was disturbed by how little was known about them. After reading about McLellan’s RSV breakthrough, he

…

and others in Graham and Ward’s labs, Wang had submitted a paper detailing their MERS research, demonstrating a potentially universal method of stabilizing the coronavirus’s spike protein to enable an effective vaccine, but the paper had been rejected by all five of the leading scientific journals. One reviewer called

…

group’s paper eventually was accepted for publication by a respected, though second-tier, journal, but most scientists ignored the research, many still uninterested in coronaviruses, a reaction that left Wang further dejected. “People will find it,” McLellan told him, trying to cheer him up. At night, Wang found it

…

while Moderna would produce the mRNA molecules, wrapping them with Benenato’s new lipids. The two partners immediately produced a vaccine for MERS-CoV, the coronavirus that was causing MERS. Their shots generated impressive levels of antibodies in tests on mice and monkeys, but before testing on humans could proceed, the

…

epidemic died out. Nevertheless, the two teams were pretty sure their shots would have proven effective, and maybe would have been enough to halt that coronavirus. They vowed to team up, once again, if a similar virus ever emerged. * * * • • • Bancel was convinced his company was making progress. Outsiders were dubious.

…

Almost simultaneously, they reached the same conclusion. “It’s SARS, it’s SARS!” Zhang said. Shit, it’s back, Holmes thought, referring to another pernicious coronavirus. Zhang and his colleagues in China began cautioning authorities in the country. After sending a warning to the NHC, Zhang boarded a flight to Wuhan

…

Davos, Switzerland, to join thousands of global leaders at the annual meeting of the World Economic Forum, he was becoming more concerned about the novel coronavirus. At the event, attendees debated economic, political, and environmental topics, and Bancel spent some time trying to understand why investors were so discouraged about

…

-19 vaccines, called mRNA-1273, to Corbett, the NIH scientist, to begin testing in mice. Within weeks, early results showed it elicited antibodies to the coronavirus, a promising, albeit early, sign. Moderna staffers were accustomed to self-confidence, even boasts, from Bancel. When he met with Fauci and the others,

…

catch Garbuz if he fell. It was more important to allay the public’s concerns than to face the new reality. * * * • • • As the new coronavirus spread, it seemed similar to most other respiratory illnesses, at least at first. Patients suffered from fever, coughs, and shortness of breath. Soon, though, it

…

became clear this one was uniquely treacherous. The novel coronavirus could affect the kidneys, heart, and liver, and the circulatory and gastrointestinal systems. Sometimes patients’ lungs filled with so much fluid they weren’t able

…

Viral particles traveled to the backs of nasal passages and to mucous membranes in the throat. Soon the virus was spreading all over the body. Coronavirus particles, with their trademark spiked proteins protruding from their spherical surfaces, hooked on to the cell membranes, enabling the virus’s genetic material to enter

…

help people to avoid the virus. Scientists began employing techniques they had developed to fight previous viruses and diseases, including AIDS, to slow the new coronavirus. It had taken years, but by early 2020, researchers at companies like Gilead Sciences, outside San Mateo, California, had introduced cocktails of antiretroviral pills

…

In early 2020, Eli Lilly and Regeneron Pharmaceuticals began producing these kinds of drugs, called monoclonal antibodies, to help some patients dealing with the new coronavirus. A cheap steroid called dexamethasone also proved capable of decreasing mortality, providing doctors with still another way to fend off Covid-19. It soon became

…

of those nations’ vaccines might not be reliable. Instead, they pinned their hopes on Western vaccine powers, such as Merck. * * * • • • As news of the new coronavirus emerged, Merck’s executives gathered at the company’s West Point, Pennsylvania, research and manufacturing site and elsewhere, debating whether to participate in what they

…

email Johan Van Hoof, the head of global vaccines at Johnson & Johnson’s Janssen Pharmaceuticals division, his partner on the HIV and Zika vaccines. “The coronavirus outbreak in China is looking bad,” Barouch wrote. “Human-to-human transmission appears quite efficient, including from asymptomatic individuals without fevers, which may make epidemic

…

was urging his company to go full speed ahead. “I had the zeal of the converted,” he says. Some of the Pfizer executives were witnessing coronavirus’s impact firsthand. Jansen and some others continued coming into the company’s Midtown Manhattan office, sometimes passing refrigerated trucks that stored victims who had

…

work. “Treatments save lives,” Schuitemaker liked to tell colleagues in Crucell’s offices in the Dutch city of Leiden. “But vaccines save populations.” When the coronavirus crisis worsened in the early spring, however, some senior J&J executives were having second thoughts about Schuitemaker’s idea of using high-potency shots

…

&J knew they might not have the first vaccine, but their shots had a chance to be the most protective and convenient. * * * • • • As the coronavirus spread, thousands of scientists around the world raced to build vaccines capable of protecting people from what increasingly seemed like a modern-day new plague

…

Failure would also likely mean other vaccine efforts were doomed, since so many shared common elements with Pfizer/BioNTech’s approach, such as targeting the coronavirus’s spike protein. Some at Pfizer had intensely personal reasons to explain why they were praying for good news. Philip Dormitzer, who along with Jansen

…

percent effective at preventing symptomatic disease in adults, more proof that Smith and his colleagues had developed one of the most effective vaccines against the coronavirus. Regulatory clearances were still months away because the company had yet to ensure that its manufacturing processes met regulatory standards. The delays meant it was

…

could relax a bit after their difficult year and eventual vaccine success. They never had a chance. As new and dangerous variant strains of the coronavirus emerged during 2021, Bancel and his colleagues scrambled to rework their vaccine, develop potential booster shots to handle new variants, and test vaccines for adolescents

…

the BioNTech scientists were even eyeing challenging diseases like tuberculosis and AIDS. His ambitions raised the tantalizing prospect that the horrors wrought by the deadly coronavirus could, in an indirect way, help vanquish some of the cruelest diseases known to humankind. Still biking to work, Şahin continued to leave colleagues

…

617.2, or the Delta variant, emerged. The variant, which swept through India before sparking waves of infection elsewhere, served as a reminder that the coronavirus wasn’t nearly finished terrorizing the world. For most people, Covid-19 vaccines provided sufficient protection from the most dangerous effects of the variant. But

…

virus that leads to seasonal disease, like influenza, as well as more painful, periodic outbreaks. Humankind will likely need to learn to live with the coronavirus, while finding creative ways to encourage unvaccinated populations to roll up their sleeves and receive shots. But if the virus is discovering creative ways to

…

out. And researchers at Walter Reed are testing a supershot that might confer immunity against a wide variety of pathogens, including new strains of the coronavirus. The researchers believe their shots will trigger such a strong immune response that they will potentially fend off many types of viruses and diseases. “

…

viruses were also discovered in central African monkeys and apes, thus ending the debate. It may take even longer to discover the origins of the coronavirus in nature. “Virologists need time,” Wain-Hobson says. * * * • • • Crises and catastrophes often result in medical breakthroughs. Ambulances and anesthesia emerged from World War I,

…

applied to civilian patients. “Society usually makes progress out of necessity,” argues Jeremy Farrar, director of the Wellcome Trust. Good has already resulted from the coronavirus crisis. Many people adopted healthier balances between their professional and personal lives and a new appreciation for family. Hopefully, these shifts will be long-lasting

…

During the worst of the 2020 crisis, Anthony Fauci received death threats and some politicians suggested that doctors were inflating the death toll from the coronavirus as a means of generating higher hospital fees. The counsel and guidance of public health authorities likely will be needed again, perhaps soon. There’

…

2020, Rabbi Lord Jonathan Sacks noted that the United States and the United Kingdom, two of the countries that had suffered the most from the coronavirus crisis, are also the nations best known for defending liberty and freedom, while prizing, even venerating, individualism. Working at The Wall Street Journal during

…

effort were likely motivated, at least in part, by fame and fortune, suggesting that promoting individual goals can bring broader benefits. Better, though, that the coronavirus crisis results in a renewed emphasis on collective relationships and an appreciation for those who make sacrifices on behalf ofothers. “I think future anthropologists will

…

Chemical & Engineering News, September 29, 2020, https://cen.acs.org/pharmaceuticals/vaccines/tiny-tweak-behind-COVID-19/98/i38. 6. Elisabeth Mahase, “Covid-19: First Coronavirus Was Described in the BMJ in 1965,” British Medical Journal 369, no. 8242 (April 2020): m1547, https://doi.org/10.1136/bmj.m1547. 7. Ivan

…

Oransky, “David Tyrrell,” Lancet 365, no. 9477 (June 2005): 2084, https://doi.org/10.1016/S0140-6736(05)66722-0; Mahase, “Covid-19: First Coronavirus.” 8. Oransky, “David Tyrrell.” 9. Yanzhong Huang, “The SARS Epidemic and Its Aftermath in China: A Political Perspective,” in Learning from SARS: Preparing for the

…

the First COVID-19 Genome Speaks Out About the Controversies Surrounding His Work,” Time, August 24, 2020, https://time.com/5882918/zhang-yongzhen-interview-china-coronavirus-genome. 10. Natasha Khan, “New Virus Discovered by Chinese Scientists Investigating Pneumonia Outbreak,” Wall Street Journal, January 8, 2020, https://www.wsj.com/articles/

…

Report—How a British COVID-19 Vaccine Went from Pole Position to Troubled Start,” Reuters, December 24, 2020, https://www.reuters.com/article/us-health-coronavirus-britain-vaccine-sp-idUKKBN28Y0XU. 5. Baker, “Covid Vaccine Front-Runner.” 6. Sarah Gilbert, “If This Doesn’t Work, I’m Not Sure Anything Will,”

…

“Trump Seeks Push to Speed Vaccine, Despite Safety Concerns,” New York Times, April 29, 2020, https://www.nytimes.com/2020/04/29/us/politics/trump-coronavirus-vaccine-operation-warp-speed.html. 8. Helen Branswell, “Vaccine Experts Say Moderna Didn’t Produce Data Critical to Assessing Covid-19 Vaccine,” STAT News, May

…

, “Decades of Work, and Half a Dose of Fortune, Drove Oxford Vaccine Success,” Reuters, November 23, 2020, https://www.reuters.com/article/us-health-coronavirus-astrazeneca-oxford/decades-of-work-and-half-a-dose-of-fortune-drove-oxford-vaccine-success-idUKKBN2832NC?edition-redirect=uk. 7. Clive Cookson et al., “How

Shutdown: How COVID Shook the World's Economy

by Adam Tooze  · 15 Nov 2021  · 561pp  · 138,158 words

LC record available at https://lccn.loc.gov/2021016843 LC ebook record available at https://lccn.loc.gov/2021016844 Cover design: Jason Ramirez Cover image: (coronavirus cell) DigitalVision Vectors / Getty Images Book design and graph illustrations by Daniel Lagin, adapted for ebook by Cora Wigen pid_prh_5.7.1_c0

…

was stressing the weakest parts of our personalities and our most intimate relationships. * * * — There have been far more lethal pandemics. What was dramatically new about coronavirus in 2020 was the scale of the response. And that begs a question. As the Financial Times’s chief economic commentator Martin Wolf put it

…

the very unequal consequences of societal risks, whether those be due to structural change in the global division of labor, environmental damage, or disease.43 Coronavirus glaringly exposed our institutional lack of preparation, what Beck called our “organized irresponsibility.” It revealed the weakness of basic apparatuses of state administration, like up

…

was a long-term world historic shift, to which everyone in the world would eventually have to respond. But Beijing’s success in handling the coronavirus and the assertiveness that unleashed were a red flag to the Trump administration. Furthermore, the superheated atmosphere of the American election generated powerful amplification and

…

vision of American government crafted by successive Democratic administrations starting with Woodrow Wilson and FDR gave American liberals tools with which to respond to the coronavirus challenge. Even the new generation of American radicals led by Alexandria Ocasio-Cortez could find things to like about the New Deal.73 By

…

implications for our history—written from the safety of an Upper West Side apartment could seem remote. The Anthropocene remained an abstract intellectual proposition. The coronavirus crisis has stripped even the most sheltered of us of that illusion. Part I DISEASE X Chapter 1 ORGANIZED IRRESPONSIBILITY Skeptics—and there have been

…

system anywhere in the world that could absorb the caseload of a runaway pandemic. Organized irresponsibility ruled. * * * — As bewildering as its impact was, the 2020 coronavirus crisis was an accident waiting to happen. Not only did our modern way of life supercharge the mutation of potentially dangerous viruses, we carry them

…

-term perspective, and to strengthen and firm up confidence.” The emphasis now was on selectivity and discipline. About half of China’s counties had no coronavirus cases. There, the priority should be “on forestalling imported cases and comprehensively restoring the order of production and life.” For medium-risk regions, the

…

adequacy of public health systems but transatlantic divisions between the United States and Europe, over trade, NATO, and climate policy. Those who were warning about coronavirus, including the WHO boss Tedros Adhanom Ghebreyesus and Kristalina Georgieva of the IMF, struggled to make themselves heard. The main stage was given over to

…

bathrooms, kitchens, or washing facilities—the dilemmas were even more acute. In a labor market hierarchy that, in any case, rewards abstract, disembodied labor, the coronavirus crisis massively compounded existing inequalities. If you had the capacity to extract yourself, you were okay. You could work remotely. You could shop remotely. You

…

of hyperglobalization, fragile and attenuated welfare states, profound social and economic inequality, and the overweening size and influence of private finance. * * * — The fiscal response to coronavirus was a striking expression of combined and uneven development. On the one hand, since virtually every country in the world joined the collective move to

…

Central banks go on a bond-buying spree to support government responses to the pandemic. Data compiled by Bloomberg, https://www.bloomberg.com/graphics/2021-coronavirus-global-debt The central banks didn’t, on the whole, buy the newly issued debt directly. They bought bonds held by banks and investment funds

…

the stock market. It increased financial net worth and boosted demand. The supportive cooperation between central banks and treasuries in the common struggle against the coronavirus was thus, the central bankers adamantly insisted, no more than an incidental side effect of their frantic and clumsy efforts to manage the economy by

…

value; this was priced to panic.”3 How would the emerging markets weather the storm? Would a financial crisis cripple their ability to respond to coronavirus? Would the advanced economies and the international financial institutions, in which the Americans and Europeans have a controlling voice, offer assistance, or would they

…

compound the pressure? The coronavirus crisis was a major test of the economic regime not just of the advanced economies, but of the entire world. * * * — The capital flight of

…

were watching the generous social spending of Bolsonaro’s government with increasing apprehension. How, they asked, would a populist administration respond to another wave of coronavirus?73 More and more investors were willing to buy only short-dated Brazilian debt.74 The new toolkit for managing the risks of financial globalization

…

of the court, but away from it, not putting European solidarity in question, but tending, instead, to reinforce it. * * * — As a near-universal experience, the coronavirus pandemic concentrated minds across the world on a single issue, inducing identification, comparison, and sympathy across borders—Chen’s convergence, linkage, induction, and amplification effects

…

sector unions.30 His hobbyhorse was a liability shield, which would enable an early return to work while protecting employers against lawsuits to do with coronavirus infection. As a license for corporate irresponsibility, this would never pass the Democratic majority in the House.31 President Trump added noise to the

…

vaccine whose efficacy and safety had been legitimately tested and whose production was ramped up to scale were very different things. The drama of the coronavirus vaccine was that for the first time, all three processes—development, testing, ramping up production—were accomplished simultaneously, on a scale intended in due

…

Home,” Responsible Statecraft, June 4, 2020. 76. J. Iadarola, “What if Bernie Has Already Won This Thing?” The Hill, February 23, 2020. S. Hamid, “The Coronavirus Killed the Revolution,” Atlantic, March 25, 2020. 77. G. Ip, “Businesses Fret Over Potential Bernie Sanders Presidency,” Wall Street Journal, March 1, 2020. B. Schwartz

…

”; ecpr.eu/Filestore/PaperProposal/0dac228d-63fb-45c6-8384-21d764abaf6a.pdf. 37. A. Folley, “Texas Lt Gov: ‘Grandparents “Don’t Want the Whole Country Sacrificed” Amid Coronavirus Closures,’ ” The Hill, March 23, 2020. 38. C. Landwehr, “Deciding How to Decide: The Case of Health Care Rationing,” Public Administration 87, no. 3 (

…

Scramble to Avert a Chernobyl Moment,” Washington Post, January 29, 2020. J. Anderlini, “Xi Jinping Faces China’s Chernobyl Moment,” Financial Times, February 10, 2020. “Coronavirus ‘Cover-up’ Is China’s Chernobyl—White House Advisor,” Reuters, May 24, 2020. 5. J. Li, “Chinese People Are Using ‘Chernobyl’ to Channel Their

…

Shutdown Is Believed to Be Without Precedent,” New York Times, January 22, 2020. 16. R. McGregor, “China’s Deep State: The Communist Party and the Coronavirus,” Lowy Institute, July 23, 2020. 17. T. Heberer, “The Chinese ‘Developmental State 3.0’ and the Resilience of Authoritarianism,” Journal of Chinese Governance 1,

…

February 24, 2020. 61. “WHO Director-General Opening Remarks at the Media Briefing on COVID-19,” World Health Organization, February 23, 2020. 62. F. Tang, “Coronavirus: Xi Jinping Rings Alarm on China Economy as Country Shifts Priority to Maintaining Growth,” South China Morning Post, February 24, 2020. 63. R. McMorrow, N

…

M. MacKenzie, “In No Mood for Catching a Falling Knife,” Financial Times, February 25, 2020. 38. R. Wigglesworth, K. Martin, and T. Stubbington, “How the Coronavirus Shattered Market Complacency,” Financial Times, February 28, 2020. 39. MacKenzie, “In No Mood for Catching a Falling Knife.” 40. S. Johnson, “Global Inventories at 7

…

South Korea’s Rapid Response to the COVID-19 Pandemic,” Transportation Research Interdisciplinary Perspectives 5 (2020): 100111. 46. Herszenhorn and Wheaton, “How Europe Failed the Coronavirus Test.” 47. L. Kudlow and K. Evans, CNBC interview transcript, February 25, 2020; www.cnbc.com/2020/02/25/first-on-cnbc-cnbc-transcript-national

…

Trump Visits CDC, Calls Jay Inslee a ‘Snake,’ ” Rev, March 6, 2020. 53. D. Agren, “Mexican Governor Prompts Outrage with Claim Poor Are Immune to Coronavirus,” Guardian, March 26, 2020. 54. “Mexico: Mexicans Need Accurate COVID-19 Information,” Human Rights Watch, March 26, 2020. 55. F. Ng’wanakilala, “Tanzanian President

…

M. Fletcher, “Britain and Covid-19: A Chronicle of Incompetence,” New Statesman, July 1, 2020. 58. J. Horowitz, “The Lost Days That Made Bergamo a Coronavirus Tragedy,” New York Times, November 29, 2020. CHAPTER 4. MARCH: GLOBAL LOCKDOWN 1. P. Smith, “An Overview and Market Size of Tradable Commodities,” The Tradable

…

, “China Laps U.S. in Latin America with Covid-19 Diplomacy,” Bloomberg, June 24, 2020. 52. L. Paraguassu and J. McGeever, “Brazil Government Ad Rejects Coronavirus Lockdown, Saying #BrazilCannotStop,” Reuters, March 27, 2020. 53. “Federal Judge Bans Bolsonaro’s ‘Brazil Cannot Stop’ Campaign,” teleSUR, March 28, 2020. 54. D. Agren, “

…

56. Morning Conference with A. M. López Obrador, “Versión estenográfica de la conferencia de prensa matutina,” March 11, 2020. 57. T. Phillips, “Mexican President Ignores Coronavirus Restrictions to Greet El Chapo’s Mother,” Guardian, March 30, 2020. 58. R. Costa and P. Rucker, “Inside Trump’s Risky Push to Reopen the

…

A. Olson and C. Bussewitz, “Child Care Crisis Pushes US Mothers Out of the Labor Force,” AP News, September 4, 2020. 35. M. Paxton, “The Coronavirus Threat to Wildlife Tourism and Conservation,” United Nations Development Programme, April 21, 2020. “Global Wildlife Tourism Generates Five Times More Revenue Than Illegal Wildlife Trade

…

Conservation.” 38. J. K. Elliot, “Thailand’s ‘Monkey City’ Overrun by Gangs of Hungry, Horny Macaques,” Global News, June 24, 2020. 39. D. Jones, “The Coronavirus Pandemic Has Halted Tourism, and Animals Are Benefiting from It,” Washington Post, April 3, 2020. 40. M. Toyana, “Jobs Gone, Investments Wasted: Africa’s Deserted

…

Stracqualursi and A. Kurtz, “Trump Administration Asking States to Delay Release of Unemployment Numbers,” CNN, March 20, 2020. 61. G. Iacurci, “Job Losses Remain ‘Enormous’: Coronavirus Unemployment Claims Are Worst in History,” CNBC, July 9, 2020. 62. “2020: Charts from a Year Like No Other,” Financial Times, December 29, 2020. 63

…

M. Ashworth, “Germany’s ‘Black Zero’ Rule May Be Gone Forever,” Bloomberg, February 26, 2020. 14. M. Nienaber, “German Parliament Suspends Debt Brake to Fight Coronavirus Outbreak,” Reuters, March 25, 2020. 15. G. Chazan, “Scholz Insists Record German Borrowing Manageable,” Financial Times, June 17, 2020. “Germany Opens the Money Tap,” Economist

…

—China’s Recovery and International Response,” ODI Economic Pulse series, November 2020. 19. J. Sipalan, “Malaysia Announces $58-Billion Stimulus Package to Cushion Impact of Coronavirus,” Reuters, March 27, 2020. 20. J. Follain, “Italian Leader Takes to Basement to Plot How to Fight Virus,” Bloomberg, March 9, 2020. 21. J.

…

of Retail Investors Are Trading with Leverage,” Yahoo!, September 9, 2020. CHAPTER 8. THE TOOLKIT 1. J. Wheatley and A. Schipani, “Bolsonaro, Brazil and the Coronavirus Crisis in Emerging Markets,” Financial Times, April 19, 2020. “COVID-19 and Global Capital Flows,” Organisation for Economic Co-operation and Development, July 3, 2020

…

. 2. http://www.worldgovernmentbonds.com/cds-historical-data/brazil/5-years/. 3. Wheatley and Schipani, “Bolsonaro, Brazil and the Coronavirus Crisis in Emerging Markets.” 4. “Global Financial Stability Report,” International Monetary Fund, October 2019. 5. D. Gabor, “The Wall Street Consensus,” SocArXiv, July 2,

…

,” Financial Times, April 17, 2020. 51. G. Long, “Ecuador Takes Far-Reaching Measures to Save Economy,” Financial Times, May 20, 2020. 52. M. Stott, “Coronavirus Set to Push 29m Latin Americans into Poverty,” Financial Times, April 27, 2020. 53. “Peru Is Heading Towards a Dangerous New Populism,” Economist, July 25

…

, June 17, 2020. 64. “Brazil Faces Hard Spending Choices in 2021,” Economist, December 16, 2020. 65. M. Viotti Beck and A. Rosati, “Brazil’s Coronavirus Splurge Is Sparking a Rebellion in Markets,” Bloomberg, October 27, 2020. 66. B. Harris, “Brazil’s Economy Rebounds in Third Quarter,” Financial Times, December 3

…

been twitter.com/70sBachchan. 54. A. Thompson, “A Running List of Record-Breaking Natural Disasters in 2020,” Scientific American, December 22, 2020. 55. T. Fuller, “Coronavirus Limits California’s Efforts to Fight Fires with Prison Labor,” New York Times, August 22, 2020. 56. J. Poushter and C. Huang, “Despite Pandemic, Many

…

D. Diamond, “The Crash Landing of ‘Operation Warp Speed,’ ” Politico, January 17, 2021. 29. LaFraniere et al., “Politics, Science and the Remarkable Race for a Coronavirus Vaccine.” 30. B. Pancevski, “Germany Boosts Investment in Covid-19 Vaccine Research,” Wall Street Journal, September 15, 2020. 31. “Germany: Investment Plan for Europe—EIB

…

for COVID-19 Vaccine Development and Manufacturing,” European Investment Bank, June 11, 2020. 32. LaFraniere et al., “Politics, Science and the Remarkable Race for a Coronavirus Vaccine.” 33. L. Facher, “Amid Broad Mistrust of FDA and Trump Administration, Drug Companies Seek to Reassure Public About Covid-19 Vaccine Safety,” Stat, September

…

and M. DeBonis, “How Moonshine, Multi-Hour Zooms and a Deadly Pandemic Pushed Congress to Approve New Stimulus,” Washington Post, December 22, 2020. C. Hulse, “Coronavirus Stimulus Bolsters Biden, Shows Potential Path for Agenda,” New York Times, December 21, 2020. 7. www.youtube.com/watch?v=qOOPzkHF6yc. N. Rummell, “Intercession of

…

), 129 Moody’s rating agency, 166, 257–58, 270 Moore, Stephen, 76 Morawiecki, Mateusz, 280 Moreno, Lenín, 8, 168 Morin, Edgar, 6 mortality rates of coronavirus pandemic, 28, 36–37, 37–41, 169, 171 mortgage-backed securities, 14, 113–15, 117, 122, 129, 144 mRNA technology, 244, 246, 289 Müller,

Rigged: How the Media, Big Tech, and the Democrats Seized Our Elections

by Mollie Hemingway  · 11 Oct 2021  · 595pp  · 143,394 words

more valid in 2020, an election year unlike any other in American history. In the lead-up to the election, thanks in part to the coronavirus pandemic that gripped the world, wide-ranging electoral reforms were implemented. Across the country at the state, local, and federal levels, political actors rammed

…

and the building of walls.”114 STAT, a health and medicine news site, ran a piece headlined, “Health Experts Warn China Travel Ban Will Hinder Coronavirus Response,” and said the ban was desired by “conservative lawmakers and far-right supporters of the president,” even as “public health experts… warn that the

…

doing too little, members of the media tried to rewrite recent history. Politico’s Dan Diamond retroactively claimed, “[I]n late January, Trump’s initial coronavirus moves were widely hailed as [a] strong and appropriate response.”117 Early on, though, the conventional wisdom was that there was no need to panic

…

Moody’s Analytics model that showed him a strong favorite to win.124 By March, the realization among Democrats and their media allies that the coronavirus outbreak was much more serious than they had previously thought coincided with the realization that they could benefit politically from a pandemic. Once Trump opponents

…

News added, “Frequent hand-washing, not wearing a face mask, is the most important step the public can take to prevent the spread of the coronavirus, the World Health Organization said.”134 Naturally, the bureaucrats’ anti-mask message was contrasted with Trump’s willingness to cast about for a wide variety

…

spreading false hope for a virus cure—and that’s not the only damage,” the Washington Post opined.143 “Trump is spreading misinformation about the coronavirus—time to take away his microphone. Cable news networks should stop airing the president’s COVID-19 press conferences live,” argued the Boston Globe.144

…

contribution had gone to a “pro-science super PAC.”148 Finally, the politicized reaction started to impact the medical community’s ability to objectively assess coronavirus treatments. A study that had concluded hydroxychloroquine was dangerous to patients received much media coverage. Then the journal The Lancet pulled it because the authors

…

media favorite list. In particular, the media were obsessed with the daily press conferences held by Cuomo, leader of the state hit hardest by the coronavirus. Anyone paying attention would have noticed that Cuomo frequently agreed with the president. After harshly criticizing Trump for saying hydroxychloroquine had promise, the media didn

…

pandemic crisis.” Politico barely stopped itself from putting actual profanity in a headline: “ ‘Dumbest S—’: DeSantis Takes Heat as He Goes His Own Way on Coronavirus.” Unlike Cuomo, DeSantis not only made the correct call not to return COVID-19 patients to nursing homes, but Florida significantly outperformed New York in

…

both per capita coronavirus cases and deaths in the state. * * * Even though the evidence showed China’s communist government, aided by an incompetent and credulous World Health Organization,

…

a “China virus” or “Wuhan virus” was xenophobic, it represented yet another shameless about-face. Media outlets had already spent months referring to the “Wuhan coronavirus” and various other names that clearly reflected the virus’s foreign origin. On March 12, the conservative Media Research Center put together a video showing

…

“we’re starting to see a message shift here because you’re starting to hear the Republicans, especially Trump, call it the ‘Wuhan’ or ‘Chinese coronavirus.’ They’re looking for someone to blame.” Cuomo’s insipid observation was then followed by nearly two minutes of clips from media figures, including several

…

CNN journalists, referring over the previous two months to the “Wuhan” or “Chinese coronavirus.”160 But the media’s shamelessness persisted. Instead of focusing on public health questions during daily White House press briefings, the press feigned outrage over

…

to the public, as had been long suspected. One email showed Peter Daszak, president of EcoHealth Alliance, thanking Fauci for publicly dismissing concerns that the coronavirus was created in a lab. EcoHealth Alliance has worked with the Wuhan Institute of Virology. In an email, Fauci also dismissed the idea that the

…

helped support that message. Whether it was the cause or effect of the messaging focus, polls showed that Democrats were much more terrified of the coronavirus than Republicans were.8 As important as a virtual convention was to Democratic messaging, an in-person convention was for Republicans. Trump repeatedly emphasized that

…

Hicks, who had traveled with the president at least three times in the previous week and participated in debate prep, had tested positive for the coronavirus.40 After midnight, Trump tweeted that he and Melania had tested positive and would begin their quarantine and recovery process immediately.41 It was a

…

very strong start to the vice-presidential debate, with a rehearsed but very effective answer criticizing the Trump administration for its failure to bring the coronavirus epidemic to heel. But when pressed for details on what she’d do differently, she struggled and never quite regained a strong footing. She

…

pay for the parts of Democrats’ mail-in ballot strategy that state and local governments themselves could do, claiming it was necessary because of the coronavirus. Congress allocated hundreds of millions of dollars, but the progressive activists needed much more to accomplish their vision. That’s when “[p]rivate philanthropy

…

Bay, Madison, Milwaukee, and Kenosha to ensure voting could be “done in accordance with prevailing public health requirements” to “reduce the risk of exposure to coronavirus.”119 Wisconsin law says voting is a right, but that voting absentee is a privilege. “[V]oting by absentee ballot must be carefully regulated to

…

was downplayed in favor of liberals’ alleging Trump was racist.49 Just as the 2020 general election campaign got going, media-induced hysteria over the coronavirus sent not just the country but the world into a tailspin. Any attempt to hold the communist government of China accountable for unleashing the virus

…

any election loss, but what Democrats did to the manner in which people vote was further destabilizing to the country. Democrats took advantage of the coronavirus global pandemic to foist upon the country election rules explicitly designed to favor their party. Since before the country was founded, Americans have been fighting

…

as Emergency Fed Action Fails to Mollify Investors,” Washington Post, March 16, 2020, https://www.washingtonpost.com/business/2020/03/16/stocks-markets-live-updates-coronavirus/. 14. “A Timeline of COVID-19 Developments in 2020,” American Journal of Managed Care, updated January 1, 2021, https://www.ajmc.com/view/a-

…

Election Puts Poll Workers at Risk of Virus,” New York Times, April 2, 2020, https://www.nytimes.com/2020/04/02/us/politics/wisconsin-election-coronavirus.html. 24. Alex Seitz-Wald and Shaquille Brewster, “GOP Lawmakers Reject Wisconsin Governor’s Call for Delay in Election Results,” NBC News, April 3,

…

State’s Latest Whipsaw,” Washington Post, April 7, 2020, https://www.washingtonpost.com/politics/wisconsin-governor-suspends-in-person-voting-in-tuesdays-elections-amid-escalating-coronavirus-fears/2020/04/06/9d658e2a-781c-11ea-b6ff-597f170df8f8_story.html. 26. Laurel White, “Postmark Irregularities Could Disqualify Ballots Sent on or before Election Day

…

Lisa Lerer, “Wisconsin Votes Tomorrow. In Person,” New York Times, April 6, 2020, https://www.nytimes.com/2020/04/06/us/politics/on-politics-wisconsin-coronavirus.html. 28. John McCormack, “CDC Study Shows No COVID-19 Spike from Wisconsin’s April Election,” National Review, July 31, 2020, https://www.nationalreview.com

…

/2020/07/cdc-study-wisconsin-elections-caused-no-coronavirus-spike/. 29. David Wahlberg, “No COVID-19 Surge in Milwaukee from Wisconsin’s April 7 Election, CDC Says,” Wisconsin State Journal, August 3, 2020,

…

, 2016,” Ballotpedia, n.d., https://ballotpedia.org/Wisconsin%27s_7th_Congressional_District_election. 43. Donald Judd, “Donald Trump Holds ‘Tele-Rally’ in Campaign First amid Coronavirus Pandemic,” CNN, July 18, 2020, https://www.cnn.com/2020/07/18/politics/donald-trump-telerally-campaign-event/index.html. 44. Bauer, “Trump-Backed Tom

…

, https://www.cbsnews.com/news/georgia-postpones-presidential-primary-scheduled-for-march-24-2020-03-14/. 66. Ben Nadler, “Georgia Postpones Primaries Again because of Coronavirus,” Associated Press, April 9, 2020, https://apnews.com/article/public-health-primary-elections-us-news-ap-top-news-elections-d0a07a2989f7399c6b14e2276b482526. 67. Richard Fausset and Reid

…

strong and appropriate response…,” Twitter, March 8, 2020, 9:22 a.m., https://twitter.com/ddiamond/status/1236643371734765568. 118. Gerry Shih et al., “As Deadly Coronavirus Spreads, U.S. to Expand Screening of Passengers from China at 20 Airports,” Washington Post, January 27, 2020, https://www.washingtonpost.com/health/as-deadly

…

9:31 p.m., https://twitter.com/RepGosar/status/1242625203844325376. 120. Lenny Bernstein, “Get a Grippe, America. The Flu Is a Much Bigger Threat Than Coronavirus, for Now,” Washington Post, February 1, 2020, https://www.washingtonpost.com/health/time-for-a-reality-check-america-the-flu-is-a-much-bigger-threat

…

-government-health-agency-official-corona-virus-isnt-something-the. 122. KPIX CBS SF Bay Area, “Speaker Pelosi Visits SF’s Chinatown to Show Support amid Coronavirus Fears,” YouTube, February 24, 2020, https://www.youtube.com/watch?time_continue=134&v=eFCzoXhNM6c&feature=emb_title. 123. David Siders, “Dems Sweat Trump’

…

concerned/. 141. Stephen Collinson, “Trump Peddles Unsubstantiated Hope in Dark Times,” CNN, March 20, 2020, https://www.cnn.com/2020/03/20/politics/donald-trump-coronavirus-false-hope/index.html. 142. Elizabeth Cohen et al., “Trump Says This Drug Has ‘Tremendous Promise,’ but Fauci’s Not Spending Money on It,” CNN

…

thats-not-the-only-damage/2020/03/25/587b26d8-6ec3-11ea-b148-e4ce3fbd85b5_story.html. 144. Michael A. Cohen, “Trump Is Spreading Misinformation about the Coronavirus—Time to Take Away His Microphone,” Boston Globe, March 20, 2020, https://www.bostonglobe.com/2020/03/20/opinion/take-away-trumps-microphone/. 145. Sonam

…

Stress This Enough, This Will Kill You’: Fox News Host Neil Cavuto Was Shocked by Trump’s Announcement That He’s Taking Hydroxychloroquine to Prevent Coronavirus,” Business Insider, May 18, 2020, https://www.businessinsider.com/fox-news-neil-cavuto-shocked-trump-hyroxychloroquine-announcement-video-2020-5. 146. Erika Edwards and Vaughn

…

thedailybeast.com/trump-addresses-kung-flu-remark-says-asian-americans-agree-100-with-him-using-chinese-virus. 163. Kamala Harris (@VP), “Calling it the ‘Chinese coronavirus’ isn’t just racist, it’s dangerous and incites discrimination against Asian Americans and Asian immigrants…,” Twitter, March 10, 2020, 12:52 p.m., https

…

Masks. China Makes Them, but Has Been Hoarding Them,” New York Times, April 2, 2020, https://www.nytimes.com/2020/03/13/business/masks-china-coronavirus.html. 170. Helen Davidson, “First COVID-19 Case Happened in November, China Government Records Show—Report,” The Guardian, March 13, 2020, https://www.theguardian.

…

/1261338735355899906?lang=en. 185. “The Upside of Crisis,” Kite and Key Media, March 2021, https://www.kiteandkeymedia.com/videos/covid-19-crisis-management-federal-government-coronavirus-pandemic-emergency-vaccine/?utm_source=social&utm_medium=twitter. 186. NPR (@NPR), “Fact Check: President Trump said of a vaccine: ‘It’s ready. It’s

…

Owermohle, “Pfizer Trying to Defuse Critics amid Push for Vaccine before Election Day,” Politico, October 9, 2020, https://www.politico.com/news/2020/10/09/coronavirus-vaccine-pfizer-election-day-428371. 189. Matthew Herper, “COVID-19 Vaccine from Pfizer and BioNTech Is Strongly Effective, Early Data from Large Trial Indicate,” STAT

…

trump-calls-george-floyds-death-a-terrible-thing-2020-05-29/. 15. Scott Neuman, “Medical Examiner’s Autopsy Reveals George Floyd Had Positive Test for Coronavirus,” NPR, June 4, 2020, https://www.npr.org/sections/live-updates-protests-for-racial-justice/2020/06/04/869278494/medical-examiners-autopsy-reveals-george-floyd

…

-had-positive-test-for-coronavirus. 16. Akshita Jain, “George Floyd’s Killing Not a Hate Crime because It Was Systemic Not ‘Explicit’ Racism, Says Official,” The Independent, April 26,

…

-convention. 10. Dan Merica, Ryan Nobles, and Jeremy Diamond, “Trump Says GOP Forced to Find New State to Host Convention as North Carolina Stands by Coronavirus Measures,” CNN, June 3, 2020, https://www.cnn.com/2020/06/02/politics/republican-national-convention-location/index.html. 11. Jim Morrill, “The RNC

…

-superspreader-event-n1242781. 13. Elle Thomas, “Sen. Mike Lee Tests Positive for COVID-19,” FOX 13, October 2, 2020, https://www.fox13now.com/news/coronavirus/local-coronavirus-news/sen-mike-lee-tests-positive-for-covid-19. 14. Jonah Goldberg, “Ruth Bader Ginsburg and a Question of Eugenics,” Chicago Tribune, July 16, 2009

…

ct-xpm-2009-07-16-0907150564-story.html. 15. Tom Hamburger, “Two Students and a Teacher at School Attended by Barrett Children Test Positive for Coronavirus,” Washington Post, October 9, 2020, https://www.washingtonpost.com/politics/barrett-children-school-covid/2020/10/09/ac130298-0a40-11eb-9be6-cf25fb429f1a_story.html. 16

…

Will Be Hospitalized ‘for the Next Few Days,’ ” CNN, October 3, 2020, https://www.cnn.com/2020/10/02/politics/president-donald-trump-walter-reed-coronavirus/index.html. 47. Jennifer Rubin (@JRubinBlogger), “Totally unacceptable we have not heard from a doctor. Has the 25th amendment been invoked???,” Twitter, October 2,

…

of ‘Inflicting’ Failures on Americans,” Daily Caller, October 4, 2020, https://dailycaller.com/2020/10/04/get-well-get-it-together-jake-tapper-trump-failures-coronavirus/. 54. Barbara Sprunt, “Despite Risks to Others, Trump Leaves Hospital Suite to Greet Supporters,” NPR, October 4, 2020, https://www.npr.org/sections/latest-

…

. 173. Christina A. Cassidy, “Voter Outreach Led to Big Drop in Rejected Mail Ballots,” Associated Press, March 16, 2021, https://apnews.com/article/politics-wisconsin-coronavirus-pandemic-elections-atlanta-25b5218ee92dadf78be274211bef6c6b. 174. Litke, “Fact Check: Wisconsin’s November Absentee Rejection Rate Was in Line.” 175. Nathaniel Rakich, “Why So Few Absentee Ballots

How to Survive a Pandemic

by Michael Greger, M.D., FACLM  · 1,072pp  · 237,186 words

? Where do new infectious diseases come from? All human viral infections are believed to originate in animals.9 The Emergence of MERS Most human coronaviruses appear to have arisen originally in bats,10 which make good viral hosts. Up to two hundred thousand can crowd together in dense roosting colonies

…

they were confined indoors. The high-intensity contact between camels alongside their workers is thought to be what helped drive the spillover of the MERS coronavirus from camels to humans. By 2011, open grazing was completely banned in Qatar, the Middle Eastern country with the highest camel density. The next

…

the genetic sequences of the viruses obtained from some of the early human victims were 99.98 percent identical despite the rapid mutation rate of coronaviruses suggests the current pandemic originated within a very short period from a single source.67 Although there have been documented reports of SARS-CoV escaping

…

mammal in the world.77 Although other potential intermediate hosts were investigated, including snakes78 and turtles,79 most attention has turned to pangolins, after a coronavirus found in diseased pangolins being smuggled from Malaysia into China was found to be about 90 percent identical with the COVID-19 virus.80 Samples

…

anyone can go online and buy Chinese bat feces (Yè ming shǎ) to “treat … eye disorders.”100 While the drying of excrement would presumably inactivate coronavirus, the handling and trade of live and recently killed bats for use in traditional remedies could infect people directly or introduce opportunities for cross infection

…

last decade,110 rapidly spreading coast to coast once it reached U.S. shores in 2014.111 This pattern of emergence and outbreaks of new coronaviruses appears to be accelerating, in part because “intensive farm-management practices result in thousands of animals being housed together in a closed environment.”112 Although

…

can do about it. And just as eliminating the exotic animal trade and live animal markets may go a long way toward preventing the next coronavirus pandemic, reforming the way we raise domesticated animals for food may help forestall the next killer flu. I STORM GATHERING 1918 “Humanity has but

…

through the mucus layer to attack the respiratory cells underneath,316 before moving aside as the hemagglutinin spikes take over. Like the spike proteins coating coronaviruses, hemagglutinin is the key the flu virus uses to get inside our cells. The cells of our body are sugar-coated. The external membrane

…

over one another, spewing potential pathogens throughout the market wet with blood and urine.1004 These viral swap meets are blamed for the transformation of coronaviruses, previously known for causing the common cold, into a killer.1005 If hindsight were twenty-twenty and the wet markets had been closed permanently,

…

performed at the Nebraska Biocontainment Unit and the National Quarantine Unit found the majority of air samples tested positive for traces of the COVID-19 coronavirus—even in the hallways outside of patients’ rooms. However, the researchers were unable to verify if the airborne virus was infectious, given the extremely

…

misted into the air,2815 special care should certainly be taken during aerosol-generating medical procedures. How long does the virus last on contaminated surfaces? Coronaviruses are “enveloped” viruses, wrapped in a stolen swath of our own cell membranes. As they bud out of infected cells, they cloak themselves in

…

However, the CDC has since published evidence by a respected team of researchers funded by the European Commission and German government that the COVID-19 coronavirus could be inactivated within thirty seconds by just 30 percent alcohol (either ethyl or isopropyl).2854 In that case, a variety of hard liquors

…

at the National Academy of Sciences told the White House that “[c]urrently available research supports the possibility that SARS-CoV-2 [the COVID-19 coronavirus] could be spread via bioaerosols generated directly by patients’ exhalation.”2892 This shouldn’t be surprising. After all, respiratory droplets are not just sneezed

…

peaking every winter,2930 there are other respiratory virus infections that peak in the spring or summer.2931 In fact, MERS-CoV, the last deadly coronavirus to cause an epidemic, peaked in August in the sweltering heat and blistering sun of the Arabian Peninsula.2932 The mechanisms underlying the seasonality of

…

80 percent alcohol were found more effective than soap in every scientific study available for review, and, as I’ve discussed, enveloped viruses such as coronaviruses and influenza are especially susceptible to topical alcohol sanitizers. Alcohol solutions not only were found to be more effective at eliminating germs, but require less

…

most highly valued barter items in crisis situations.3047 As I mentioned before, a group of respected researchers posted preliminary evidence that the COVID-19 coronavirus could be inactivated by half that alcohol concentration, but for an all-purpose pandemic sanitizer—one rub to rule them all—I would recommend sticking

…

Francisco mayor threatened to arrest anyone unmasked.3054 Within thirty-six hours, the SFPD had hauled in 175 “mask-slackers.”3055 The main mode of coronavirus and influenza virus transmission may be coughed and exhaled respiratory droplets of virus-laden mucus and saliva. Conversational speech alone can produce thousands of these

…

plans.3081 Currently, the WHO recommends masks only for asymptomatic individuals if they are taking care of someone suspected of infection with the COVID-19 coronavirus.3082 In terms of individual strategies, the best recommendation may be what finally shook out of the SARS crisis:3083 in public, surgical masks

…

tonight.”3226 Just as past experience with SARS may have helped countries like Singapore and Taiwan better deal with COVID-19, hard lessons from the coronavirus pandemic will hopefully translate into global readiness for the next one. Pandemic planning needs to be on the agenda of every institution, including every school

…

: WHO; [accessed 2020 Mar 23]. https://www.who.int/csr/sars/country/table2004_04_21/en/. 8. World Health Organization. 2019. Middle East respiratory syndrome coronavirus (MERS-CoV). Geneva: WHO; [updated 2019 Nov; accessed 2020 Mar 23]. http://origin.who.int/emergencies/mers-cov/en. 9. Weber J, Alcorn K.

…

2020 Jan 25. Live animal markets worldwide can spawn diseases, experts say. Voice of America. [accessed 2020 Apr 11]; https://www.voanews.com/science-health/coronavirus-outbreak/live-animal-markets-worldwide-can-spawn-diseases-experts-say. 49. Zhong NS, Zeng GQ. 2008. Pandemic planning in China: applying lessons from severe acute

…

Wassenaar TM, Zou Y. 2020. 2019_nCoV/SARS-CoV-2: rapid classification of betacoronaviruses and identification of Traditional Chinese Medicine as potential origin of zoonotic coronaviruses. Lett Appl Microbiol. 70(5):342–348. https://doi.org/10.1111/lam.13285. 102. National Administration of Traditional Chinese Medicine. 2020 Feb 4.

…

Notice on the issuance of a new coronavirus infection pneumonia diagnosis and treatment plan. Beijing: National Health Commission. Report No.: 103. http://www.gov.cn/zhengce/zhengceku/2020-02/05/5474791/files/de44557832ad4be1929091dcbcfca891

…

Peng L, Zhou J, Zhu SJ, Huang Y-W. 2019. Broad cross-species infection of cultured cells by bat HKU2-related swine acute diarrhea syndrome coronavirus and identification of its replication in murine dendritic cells in vivo highlight its potential for diverse interspecies transmission. J Virol. 93(24):e01448-19. https

…

Cook RA. 2005. The human-animal link. Foreign Affairs 84(4):38–50. 984. Bell D, Roberton S, Hunter PR. 2004. Animal origins of SARS coronavirus: Possible links with the international trade in small carnivores. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1447):1107–14

…

20. www.usatoday.com/news/offbeat/2004-01-20-civet-coffee_x.htm. 991. Bell D, Roberton S, Hunter PR. 2004. Animal origins of SARS coronavirus: possible links with the international trade in small carnivores. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1447):1107–14

…

China Daily, October 14. english.people.com.cn/200410/12/eng20041012_159879.html. 999. Bell D, Roberton S, Hunter PR. 2004. Animal origins of SARS coronavirus: possible links with the international trade in small carnivores. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences 359(1447):1107–14

…

and Prevention, Emerging Infectious Diseases 11(10). www.cdc.gov/ncidod/EID/vol11no10/05-0513.htm. 1066. Afelt A, Frutos R, Devaux C. 2018. Bats, coronaviruses, and deforestation: toward the emergence of novel infectious diseases? Front Microbiol. 9:702. https://doi.org/10.3389/fmicb.2018.00702. 1067. Fritsch P. 2003

…

6. 1959. Shortridge KF. 1992. Pandemic influenza: a zoonosis? Seminars in Respiratory Infections 7:11–25. 1960. Afelt A, Frutos R, Devaux C. 2018. Bats, coronaviruses, and deforestation: toward the emergence of novel infectious diseases? Front Microbiol. 9:702. https://dx.doi.org/10.3389/fmicb.2018.00702. 1961. Webster RG

…

/channel/health/mg18825215.900.html. 2584. Bush RM. 2004. Influenza as a model system for studying the cross-species transfer and evolution of the SARS coronavirus. Philosophical Transactions of the Royal Society of London B 359:1067–73. 2585. Goodman J. 2005. Meeting the challenge of pandemic vaccine preparedness: an

…

who-audio-script-ncov-rresser-unog-29jan2020.pdf. 2669. Tedros AG. 2020 Jan 30. WHO Director-General’s statement on IHR Emergency Committee on Novel Coronavirus (2019-nCoV). World Health Organization. [accessed 2020 Mar 31]. https://www.who.int/dg/speeches/detail/who-director-general-s-statement-on-ihr-emergency-committee

…

31]. https://doi.org/10.1101/2020.03.15.20035360. 2712. Zhang Y. 2020 Feb 17. The epidemiological characteristics of an outbreak of 2019 novel coronavirus diseases (COVID-19)—China, 2020. Chinese Center for Disease Control and Prevention. CCDC Weekly. [accessed 2020 Mar 31]. http://weekly.chinacdc.cn/en/article/

…

V, Noulette J, Duhamel A, Labreuche J, Mathieu D, Pattou F, Jourdain M, et al. 2020. High prevalence of obesity in severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) requiring invasive mechanical ventilation. Obesity. Accepted articles. [accessed 2020 Apr 11]. https://doi.org/10.1002/oby.22831. 2725. Huang R

…

active during self-quarantine. Copenhagen: WHO Regional Office for Europe; [accessed 2020 Mar 31]. http://www.euro.who.int/en/health-topics/health-emergencies/coronavirus-covid-19/novel-coronavirus-2019-ncov-technical-guidance/stay-physically-active-during-self-quarantine. 2768. World Health Organization. 2018 Oct 23. Healthy diet. Geneva: WHO; [accessed 2020

…

infection, innate immunity, and childhood. JAMA Pediatr. 169(10):956–963. https://doi.org/10.1001/jamapediatrics.2015.1387. 2770. Zimmermann P, Curtis N. 2020. Coronavirus infections in children including COVID-19: an overview of the epidemiology, clinical features, diagnosis, treatment and prevention options in children. Pediatr Infect Dis J. [Epub

…

on inanimate surfaces. Microbes Environ. 30(2):140–144. https://doi.org/10.1264/jsme2.ME14145. 2817. Geller C, Varbanov M, Duval RE. 2012. Human coronaviruses: insights into environmental resistance and its influence on the development of new antiseptic strategies. Viruses. 4(11):3044–3068. https://doi.org/10.3390/v4113044

…

J, Engelmann M, Todt D, Windisch MP, et al. Virucidal activity of World Health Organization-recommended formulations against enveloped viruses, including Zika, Ebola, and emerging coronaviruses. J Infect Dis. 215(6):902–906. https://doi.org/10.1093/infdis/jix046. 2851. Boyce JM, Pittet D. 2002. Guideline for hand hygiene in

…

our-services/public-cleanliness/environmental-cleaning-guidelines/guidelines-for-environmental-cleaning-and-disinfection. 2859. Kampf G, Todt D, Pfaender S, Steinmann E. 2020. Persistence of coronaviruses on inanimate surfaces and their inactivation with biocidal agents. J Hosp Infect. 104(3):246–251. https://doi.org/10.1016/j.jhin.2020.01

…

1, 2020). Washington(DC): National Academies Press. https://doi.org/10.17226/25769. 2893. Cohen J. 2020 Mar 27. Not wearing masks to protect against coronavirus is a ‘big mistake,’ top Chinese scientist says. Science. [accessed 2020 Apr 6]. https://doi.org/10.1126/science.abb9368. 2894. Centers for Disease Control

…

and Prevention. 2020. Coronavirus disease 2019 (COVID-19): recommendations for cloth face covers. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 3; accessed 2020 Apr

…

people—STOP BUYING MASKS! Twitter.com; [accessed 2020 Apr 6]. https://twitter.com/surgeon_general/status/1233725785283932160. 2896. Centers for Disease Control and Prevention. 2020. Coronavirus disease 2019 (COVID-19): recommendations for cloth face covers. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 3; accessed 2020 Apr

…

6]. https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/cloth-face-cover.html. 2897. Centers for Disease Control and Prevention. 2009 Sep 24. Interim recommendations for facemask and respirator

…

cloth face covers FAQs. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 4; accessed 2020 Apr 6]. https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/cloth-face-cover-faq.html. 2905. Livingston E, Desai A, Berkwits M. 2020. Sourcing personal protective equipment during the COVID

…

ultrafine particles. medRxiv.org. [accessed 2020 Apr 19]. https://doi.org/10.1101/2020.04.14.20065375. 2910. Centers for Disease Control and Prevention. 2020. Coronavirus disease 2019 (COVID-19): cloth face covers. U.S. Department of Health and Human Services; [last reviewed 2020 Apr 4; accessed 2020 Apr 6]. https

…

://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/diy-cloth-face-coverings.html. 2911. National Environmental Agency. 2020 Jan 28. Interim guidelines for environmental cleaning and disinfection in

…

and recommendations for national measures before and during pandemics. www.who.int/csr/resources/publications/influenza/GIP_2005_5Eweb.pdf. 3082. World Health Organization. 2020. Coronavirus disease (COVID-19) advice for the public: when and how to use masks. Geneva: WHO; [accessed 2020 Apr 7]. https://www.who.int/emergencies/

The Code Breaker: Jennifer Doudna, Gene Editing, and the Future of the Human Race

by Walter Isaacson  · 9 Mar 2021  · 700pp  · 160,604 words

the Middle Ages, by repeated viral epidemics. Always prepared and methodical, Doudna (pronounced DOWD-nuh) presented slides that suggested ways they might take on the coronavirus. She led by listening. Although she had become a science celebrity, people felt comfortable engaging with her. She had mastered the art of being tightly

…

acid (RNA) and a similar molecule that lacks one oxygen atom and thus is called deoxyribonucleic acid (DNA). From an evolutionary perspective, both the simplest coronavirus and the most complex human are essentially protein-wrapped packages that contain and seek to replicate the genetic material encoded by their nucleic acids. The

…

the understanding of how little strands of RNA behaved would become increasingly important, both to the field of gene editing and to the fight against coronaviruses. * * * As a young PhD student, Doudna mastered the special combination of skills that distinguished Szostak and other great scientists: she was good at doing

…

a field that would become unexpectedly relevant later in her career: viruses. Specifically, she was interested in how the RNA in some viruses, such as coronaviruses, allow them to hijack the protein-making machinery of cells. During her first semester at Berkeley, in the fall of 2002, there was an

…

. The hope then was that drugs based on RNA interference might someday be a good option for treating severe viral infections, including those from new coronaviruses.7 * * * Doudna’s paper on RNA interference appeared in Science in January 2006. A few months later, a paper published in a little-known

…

pursued an oddity of nature out of pure curiosity, and that seeded the ground for applied technologies such as gene editing and tools to fight coronaviruses. However, as with the transistor, it was not simply a one-way linear progression. Instead, there was an iterative dance among basic scientists, practical

…

her proposal to the foundation. It was a prelude to the funding Doudna would receive from Gates in 2020 to use CRISPR systems to detect coronaviruses.7 CHAPTER 16 Emmanuelle Charpentier The wanderer Conferences can have consequences. While attending one in Puerto Rico in the spring of 2011, Doudna had

…

super-high cholesterol, and male pattern baldness.14 In March of that year, however, most academic research labs were temporarily shut down because of the coronavirus pandemic. An exception was made for labs that were engaged in fighting the virus. Many CRISPR researchers, Doudna foremost among them, would shift their focus

…

commanding MIT biology professor named David Baltimore, who that year would win the Nobel Prize for his work showing that viruses containing RNA, such as coronaviruses, can insert their genetic material into the DNA of a host cell through a process known as “reverse transcription.” In other words, the RNA

…

to fix such traits cross the line from health treatment to enhancement? What about genetic modifications that help prevent a person from getting HIV or coronavirus or cancer or Alzheimer’s? Perhaps for these we need a third category called “preventions” in addition to the ill-defined “treatments” and “enhancements.”

…

is reproductive fitness—what traits might cause an organism to reproduce more—which means it permits, and perhaps even encourages, all sorts of plagues, including coronaviruses and cancers, that afflict an organism once its childbearing use is over. This does not mean that, out of respect for nature, we should quit

…

searching for ways to fight against coronaviruses and cancer.16 * * * There is, however, a more profound argument against playing God, best articulated by the Harvard philosopher Michael Sandel. If we humans

…

us would regard Alzheimer’s or Huntington’s to be a result of giftedness. When we create chemotherapies to fight cancer or vaccines to fight coronaviruses or gene-editing tools to fight birth defects, we are, quite properly, exercising mastery over nature rather than accepting the unbidden as a gift.

…

be used by humans to detect and destroy viruses. More important, she had become a maestro of collaboration. It became clear to her that battling coronavirus would require putting together teams that spanned many specialties. Fortunately, she had a base from which she could build such an effort. She had

…

DNA. The viral sequence provides the code for making a mere twenty-nine proteins.4 Here is a sample snippet of the letters in the coronavirus’s RNA: CCUCGGCGGGCACGUAGUGUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUC. That sequence is part of a string that codes for making a protein that sits on the outside of the virus shell

…

have been frozen in a liquid, structural biologists were able to create a precise model, atom by atom and twist by twist, of the coronavirus and its spikes. With the sequencing information and structural data in hand, molecular biologists began racing to find treatments and vaccines that would block the

…

sending out group emails, arranging Zoom meetings, and coordinating equipment.” Berkeley’s legal team came up with a policy for sharing discoveries freely with other coronavirus researchers while protecting the underlying intellectual property. At one of the first meetings, a university lawyer laid out a template for royalty-free licensing. “We

…

Hockemeyer watches CHAPTER 49 Testing America’s failure The first official guidance to local health officials in the U.S. about testing for the new coronavirus came in a conference call on January 15, 2020, led by Stephen Lindstrom, a microbiologist at the Centers for Disease Control (CDC). The CDC

…

Secretary Alex Azar, whose department oversees the FDA, declared a public health emergency. The declaration gave the FDA the right to speed up approvals for coronavirus tests. But it had a weird unintended consequence. In normal circumstances, hospitals and university labs can devise their own tests to use at their facilities

…

volunteer army When Doudna and her colleagues at Berkeley’s Innovative Genomics Institute decided at their March 13 meeting to focus on building their own coronavirus testing lab, there was a discussion about what technology to use. Should it be the cumbersome but reliable process of amplifying the genetic material

…

conference, Doudna watched proudly when Hamilton presented her research on using virus-like particles to deliver CRISPR-Cas9 gene-editing tools into humans. When the coronavirus crisis hit in early March, Hamilton told Doudna that she wanted to get involved like people at her University of Washington alma mater were. So

…

Zhang with Patrick Hsu CHAPTER 51 Mammoth and Sherlock CRISPR as a detection tool At the March 13 meeting that Doudna convened to address the coronavirus, she decided that a top priority was to create a high-speed conventional PCR testing lab. But during the discussion, Fyodor Urnov suggested that

…

they also consider a more innovative idea: using CRISPR to detect the RNA of the coronavirus, similar to how bacteria use CRISPR to detect attacking viruses. “There’s a paper that just came out on that,” a participant interjected. Urnov

…

“Check out the resource provided by Mammoth,” he tweeted, including a link to its white paper. “Glad that scientists are working together and sharing openly. #coronavirus.” That tweet reflected a welcome new trend in the CRISPR world. The passionate competition for patents and prizes had led to secrecy about research and

…

the formation of competing CRISPR companies. But the urgency that Doudna and Zhang and their colleagues felt about defeating the coronavirus pushed them to be more open and willing to share their work. Competition was still an important, and useful, part of the equation. There

…

genetically reengineered a safe virus—an adenovirus that causes flu in chimpanzees—by editing into it the gene to make the spike protein of the coronavirus. Similar vaccines developed by other companies in 2020 used a human version of the adenovirus. The vaccine created by Johnson & Johnson, for example, used

…

why this technique is unpopular, especially with those on the receiving end. * * * One of the teams that Doudna organized at the beginning of the coronavirus crisis in March 2020 focused on these delivery challenges facing DNA vaccines. It was led by her former student Ross Wilson, who now runs his

…

BioNTech launched what they dubbed Project Lightspeed to devise a vaccine based on RNA sequences that would cause human cells to make versions of the coronavirus’s spike protein. Once it looked promising, Şahin called Kathrin Jansen, the head of vaccine research and development at Pfizer. The two companies had

…

blood in September, streaming it live on the internet for everyone to watch, Zayner found evidence that he had developed neutralizing antibodies to fight the coronavirus. He called it a “mild success,” but noted that biology often produces murky results. It gave him a greater appreciation for careful clinical trials.

…

Cameron Myhrvold CHAPTER 54 CRISPR Cures The development of vaccines—both the conventional sort and those employing RNA—would eventually help to beat back the coronavirus pandemic. But they are not a perfect solution. They rely on stimulating a person’s immune system, always a risky thing to do. (Most

…

we could actually deliver on quickly.” In the West Coast orbit of Jennifer Doudna, however, there was a team that was pushing forward with a coronavirus treatment. Similar to the CARVER system that Myhrvold had invented, it would use CRISPR to seek and destroy viruses. Stanley Qi and PAC-MAN

…

. People use these regularly to prepare the lung to be less allergic if they are exposed to something.” The same could be done during a coronavirus pandemic; people could use a nasal spray so that PAC-MAN or another CRISPR-Cas13 prophylactic treatment will protect them. * * * Once the delivery mechanisms

…

, we are a social animal, an instinct that cannot fully be satisfied online. Nevertheless, there will be an upside to the fact that the coronavirus has expanded how we work together and share ideas. By hastening the Age of Zoom, the pandemic will broaden the horizons of scientific collaboration, allowing

…

practical applications. CRISPR and COVID are speeding our entry into a life-science era. Molecules are becoming the new microchips. At the height of the coronavirus crisis, Doudna was asked to write a piece for The Economist on the social transformations being wrought. “Like many other aspects of life these

…

not have coalesced so quickly if they had to worry about intellectual property arrangements. Likewise, scientists around the world contributed to an open database of coronavirus sequences that, by the end of August 2020, had thirty-six thousand entries.4 The sense of urgency about COVID also brushed back the gatekeeper

…

process of building on each new finding and allowed the public to follow the advance of science as it happened. On some important papers involving coronavirus, publication on the reprint servers led to crowdsourced vetting and wisdom from experts around the world.5 George Church says he had long wondered

…

be cross-disciplinary, breaking down academic silos and the walls between labs, which have traditionally been independent fiefdoms that fiercely guard their autonomy. Fighting the coronavirus required collaboration across disciplines. In that way, it resembled the effort to develop CRISPR, which involved microbe-hunters working with geneticists, structural biologists, biochemists,

…

. 3. Author’s interviews with Dave Savage, Gavin Knott, and Jennifer Doudna. 4. Jonathan Corum and Carl Zimmer, “Bad News Wrapped in Protein: Inside the Coronavirus Genome,” New York Times, Apr. 3, 2020; GenBank, National Institutes of Health, SARS-CoV-2 Sequences, updated Apr. 14, 2020. 5. Alexander Walls… David

…

30, 2019; Daniel Chertow, “Next-Generation Diagnostics with CRISPR,” Science, Apr. 27, 2018; Ann Gronowski “Who or What Is SHERLOCK?,” EJIFCC, Nov. 2018. Chapter 52: Coronavirus Tests 1. Author’s interviews with Feng Zhang. 2. Feng Zhang, Omar Abudayyeh, and Jonathan Gootenberg, “A Protocol for Detection of COVID-19 Using CRISPR

…

Diagnostics,” Broad Institute website, posted Feb. 14, 2020; Carl Zimmer, “With Crispr, a Possible Quick Test for the Coronavirus,” New York Times, May 5, 2020. 3. Goldberg, “CRISPR Comes to COVID”; “Sherlock Biosciences and Binx Health Announce Global Partnership to Develop First CRISPR-Based

…

COVID-19 Outbreak,” Biocentury, Feb. 28, 2020. 5. James Broughton… Charles Chiu, Janice Chen, et al., “A Protocol for Rapid Detection of the 2019 Novel Coronavirus SARS-CoV-2 Using CRISPR Diagnostics: SARS-CoV-2 DETECTR,” Mammoth Biosciences website, posted Feb. 15, 2020. The full Mammoth paper with patient data and

…

CoV-2,” Nature Biotechnology, Apr. 16, 2020 (received Mar. 5, 2020). See also Eelke Brandsma… and Emile van den Akker, “Rapid, Sensitive and Specific SARS Coronavirus-2 Detection: A Multi-center Comparison between Standard qRT-PCR and CRISPR Based DETECTR,” medRxiv, July 27, 2020. 6. Julia Joung… Jonathan S. Gootenberg, Omar

…

31, 2020. 14. Sharon LaFraniere, Katie Thomas, Noah Weiland, David Gelles, Sheryl Gay Stolberg and Denise Grady, “Politics, Science and the Remarkable Race for a Coronavirus Vaccine,” New York Times, Nov. 21, 2020; author’s interviews with Noubar Afeyan, Moncef Slaoui, Philip Dormitzer, Christine Heenan. Chapter 54: CRISPR Cures 1. David

…

s Next Virus Killer?,” Wired, Mar. 10, 2020. 16. Timothy Abbott… and Lei [Stanley] Qi, “Development of CRISPR as a Prophylactic Strategy to Combat Novel Coronavirus and Influenza,” bioRxiv, Mar. 14, 2020. 17. Author’s interview with Stanley Qi. 18. IGI weekly Zoom meeting, Mar. 22, 2020; author’s interviews with

…

starter cultures and, xviii, 90–92, 133, 143 CRISPR applications, 243–63 affordability of, 247–48 biohacking, 253–57, 263, 285, 288, 443–44 coronavirus testing, 413, 417 cures for viral infections, 449–57 CARVER, 452–53, 455–57 PAC-MAN, 454–57, 460 defense against terrorists, 259–63 diagnostic

…

, 107–8 fluorescent proteins, 165–67, 382–83 flytrap plants, 171 FokI enzyme, 155 Fonfara, Ines, 137 Food and Drug Administration (FDA), 294, 363, 446 coronavirus tests and, 407–10 Foy, Shaun, 205–7 Frangoul, Haydar, 244 Frankenstein (Shelley), 267, 269, 283, 286, 297 Franklin, Benjamin, 479 Franklin, Rosalind, 21–

…

Jacket montage by Debra Lill Jacket photograph of Jennifer Doudna by Brad Torchia/August Image (The letters are part of the RNA code of the coronavirus that causes COVID.) Library of Congress Cataloging-in-Publication Data Names: Isaacson, Walter, author.Title: The code breaker : Jennifer Doudna, gene editing, and the

Covid-19: The Pandemic That Never Should Have Happened and How to Stop the Next One

by Debora MacKenzie  · 13 Jul 2020  · 266pp  · 80,273 words

The Plague Year: America in the Time of Covid

by Lawrence Wright  · 7 Jun 2021  · 391pp  · 112,312 words

The Survival of the City: Human Flourishing in an Age of Isolation

by Edward Glaeser and David Cutler  · 14 Sep 2021  · 735pp  · 165,375 words

Spike: The Virus vs The People - The Inside Story

by Jeremy Farrar and Anjana Ahuja  · 15 Jan 2021  · 245pp  · 71,886 words

Pandemic, Inc.: Chasing the Capitalists and Thieves Who Got Rich While We Got Sick

by J. David McSwane  · 11 Apr 2022  · 368pp  · 102,379 words

Merchants of the Right: Gun Sellers and the Crisis of American Democracy

by Jennifer Carlson  · 2 May 2023  · 279pp  · 100,877 words

In Covid's Wake: How Our Politics Failed Us

by Stephen Macedo and Frances Lee  · 10 Mar 2025  · 393pp  · 146,371 words

The Viral Underclass: The Human Toll When Inequality and Disease Collide

by Steven W. Thrasher  · 1 Aug 2022  · 361pp  · 110,233 words

Duty of Care: One NHS Doctor's Story of the Covid-19 Crisis

by Dr Dominic Pimenta  · 2 Sep 2020  · 304pp  · 95,306 words

The Lonely Century: How Isolation Imperils Our Future

by Noreena Hertz  · 13 May 2020  · 506pp  · 133,134 words

Ten Lessons for a Post-Pandemic World

by Fareed Zakaria  · 5 Oct 2020  · 289pp  · 86,165 words

Breathtaking: Inside the NHS in a Time of Pandemic

by Rachel Clarke  · 26 Jan 2021  · 199pp  · 63,844 words

Vaxxers: The Inside Story of the Oxford AstraZeneca Vaccine and the Race Against the Virus

by Sarah Gilbert and Catherine Green  · 7 Jul 2021  · 296pp  · 96,568 words

Longshot

by David Heath  · 18 Jan 2022

Essential: How the Pandemic Transformed the Long Fight for Worker Justice

by Jamie K. McCallum  · 15 Nov 2022  · 349pp  · 99,230 words

Limitless: The Federal Reserve Takes on a New Age of Crisis

by Jeanna Smialek  · 27 Feb 2023  · 601pp  · 135,202 words

Deadly Quiet City: True Stories From Wuhan

by Murong Xuecun  · 7 Mar 2023  · 236pp  · 73,008 words

Tenants: The People on the Frontline of Britain's Housing Emergency

by Vicky Spratt  · 18 May 2022  · 371pp  · 122,273 words

Covid by Numbers

by David Spiegelhalter and Anthony Masters  · 28 Oct 2021

Risk: A User's Guide

by Stanley McChrystal and Anna Butrico  · 4 Oct 2021  · 489pp  · 106,008 words

The Dying Citizen: How Progressive Elites, Tribalism, and Globalization Are Destroying the Idea of America

by Victor Davis Hanson  · 15 Nov 2021  · 458pp  · 132,912 words

Border and Rule: Global Migration, Capitalism, and the Rise of Racist Nationalism

by Harsha Walia  · 9 Feb 2021

The New Map: Energy, Climate, and the Clash of Nations

by Daniel Yergin  · 14 Sep 2020

Reset

by Ronald J. Deibert  · 14 Aug 2020

Trillion Dollar Triage: How Jay Powell and the Fed Battled a President and a Pandemic---And Prevented Economic Disaster

by Nick Timiraos  · 1 Mar 2022  · 357pp  · 107,984 words

The Wires of War: Technology and the Global Struggle for Power

by Jacob Helberg  · 11 Oct 2021  · 521pp  · 118,183 words

The Lords of Easy Money: How the Federal Reserve Broke the American Economy

by Christopher Leonard  · 11 Jan 2022  · 416pp  · 124,469 words

Spillover: Animal Infections and the Next Human Pandemic

by David Quammen  · 30 Sep 2012  · 669pp  · 195,743 words

The Controlled Demolition of the American Empire

by Jeff Berwick and Charlie Robinson  · 14 Apr 2020  · 491pp  · 141,690 words

Rule of the Robots: How Artificial Intelligence Will Transform Everything

by Martin Ford  · 13 Sep 2021  · 288pp  · 86,995 words

COVID-19: Everything You Need to Know About the Corona Virus and the Race for the Vaccine

by Michael Mosley  · 1 Jun 2020  · 89pp  · 27,057 words

Them and Us: How Immigrants and Locals Can Thrive Together

by Philippe Legrain  · 14 Oct 2020  · 521pp  · 110,286 words

The Miracle Pill

by Peter Walker  · 21 Jan 2021  · 372pp  · 98,659 words

How the World Ran Out of Everything

by Peter S. Goodman  · 11 Jun 2024  · 528pp  · 127,605 words

How to Prevent the Next Pandemic

by Bill Gates  · 2 May 2022  · 406pp  · 88,977 words

The COVID-19 Catastrophe: What's Gone Wrong and How to Stop It Happening Again

by Richard Horton  · 31 May 2020  · 106pp  · 33,210 words

Arriving Today: From Factory to Front Door -- Why Everything Has Changed About How and What We Buy

by Christopher Mims  · 13 Sep 2021  · 385pp  · 112,842 words

J.K. Lasser's Your Income Tax 2022: For Preparing Your 2021 Tax Return

by J. K. Lasser Institute  · 21 Dec 2021

The Premonition: A Pandemic Story

by Michael Lewis  · 3 May 2021  · 285pp  · 98,832 words

The Pandemic Century: One Hundred Years of Panic, Hysteria, and Hubris

by Mark Honigsbaum  · 8 Apr 2019  · 529pp  · 150,263 words

Investing to Save the Planet: How Your Money Can Make a Difference

by Alice Ross  · 19 Nov 2020  · 197pp  · 53,831 words

The Wake-Up Call: Why the Pandemic Has Exposed the Weakness of the West, and How to Fix It

by John Micklethwait and Adrian Wooldridge  · 1 Sep 2020  · 134pp  · 41,085 words

Imaginable: How to See the Future Coming and Feel Ready for Anything―Even Things That Seem Impossible Today

by Jane McGonigal  · 22 Mar 2022  · 420pp  · 135,569 words

The Corona Crash: How the Pandemic Will Change Capitalism

by Grace Blakeley  · 14 Oct 2020  · 82pp  · 24,150 words

Nothing Personal: My Secret Life in the Dating App Inferno

by Nancy Jo Sales  · 17 May 2021  · 445pp  · 135,648 words

Fulfillment: Winning and Losing in One-Click America

by Alec MacGillis  · 16 Mar 2021  · 426pp  · 136,925 words

The Bill Gates Problem: Reckoning With the Myth of the Good Billionaire

by Tim Schwab  · 13 Nov 2023  · 618pp  · 179,407 words

The Day the World Stops Shopping

by J. B. MacKinnon  · 14 May 2021  · 368pp  · 109,432 words

Other Pandemic: How QAnon Contaminated the World

by James Ball  · 19 Jul 2023  · 317pp  · 87,048 words

Forward: Notes on the Future of Our Democracy

by Andrew Yang  · 15 Nov 2021

The Hype Machine: How Social Media Disrupts Our Elections, Our Economy, and Our Health--And How We Must Adapt

by Sinan Aral  · 14 Sep 2020  · 475pp  · 134,707 words

Brexit Unfolded: How No One Got What They Want (And Why They Were Never Going To)

by Chris Grey  · 22 Jun 2021  · 334pp  · 91,722 words

Seven Crashes: The Economic Crises That Shaped Globalization

by Harold James  · 15 Jan 2023  · 469pp  · 137,880 words

How to Spend a Trillion Dollars

by Rowan Hooper  · 15 Jan 2020  · 285pp  · 86,858 words

The Dream of Europe: Travels in the Twenty-First Century

by Geert Mak  · 27 Oct 2021  · 722pp  · 223,701 words

Dangerous Ideas: A Brief History of Censorship in the West, From the Ancients to Fake News

by Eric Berkowitz  · 3 May 2021  · 412pp  · 115,048 words

There Is Nothing for You Here: Finding Opportunity in the Twenty-First Century

by Fiona Hill  · 4 Oct 2021  · 569pp  · 165,510 words

The Data Detective: Ten Easy Rules to Make Sense of Statistics

by Tim Harford  · 2 Feb 2021  · 428pp  · 103,544 words

The Land of Hope and Fear: Israel's Battle for Its Inner Soul

by Isabel Kershner  · 16 May 2023  · 472pp  · 145,476 words

Empireland: How Imperialism Has Shaped Modern Britain

by Sathnam Sanghera  · 28 Jan 2021  · 430pp  · 111,038 words

Vulture Capitalism: Corporate Crimes, Backdoor Bailouts, and the Death of Freedom

by Grace Blakeley  · 11 Mar 2024  · 371pp  · 137,268 words

The War Below: Lithium, Copper, and the Global Battle to Power Our Lives

by Ernest Scheyder  · 30 Jan 2024  · 355pp  · 133,726 words

Chaos Kings: How Wall Street Traders Make Billions in the New Age of Crisis

by Scott Patterson  · 5 Jun 2023  · 289pp  · 95,046 words

Work Won't Love You Back: How Devotion to Our Jobs Keeps Us Exploited, Exhausted, and Alone

by Sarah Jaffe  · 26 Jan 2021  · 490pp  · 153,455 words

The Future of Money: How the Digital Revolution Is Transforming Currencies and Finance

by Eswar S. Prasad  · 27 Sep 2021  · 661pp  · 185,701 words

Fed Up!: Success, Excess and Crisis Through the Eyes of a Hedge Fund Macro Trader

by Colin Lancaster  · 3 May 2021  · 245pp  · 75,397 words

Stakeholder Capitalism: A Global Economy That Works for Progress, People and Planet

by Klaus Schwab and Peter Vanham  · 27 Jan 2021  · 460pp  · 107,454 words

Stakeholder Capitalism: A Global Economy That Works for Progress, People and Planet

by Klaus Schwab  · 7 Jan 2021  · 460pp  · 107,454 words

News and How to Use It: What to Believe in a Fake News World

by Alan Rusbridger  · 26 Nov 2020  · 371pp  · 109,320 words

Four Battlegrounds

by Paul Scharre  · 18 Jan 2023

Amazon Unbound: Jeff Bezos and the Invention of a Global Empire

by Brad Stone  · 10 May 2021  · 569pp  · 156,139 words

The World for Sale: Money, Power and the Traders Who Barter the Earth’s Resources

by Javier Blas and Jack Farchy  · 25 Feb 2021  · 565pp  · 134,138 words

The Stolen Year

by Anya Kamenetz  · 23 Aug 2022  · 347pp  · 103,518 words

Life on the Rocks: Building a Future for Coral Reefs

by Juli Berwald  · 4 Apr 2022  · 495pp  · 114,451 words

The Quiet Damage: QAnon and the Destruction of the American Family

by Jesselyn Cook  · 22 Jul 2024  · 321pp  · 95,778 words

Revenge of the Tipping Point: Overstories, Superspreaders, and the Rise of Social Engineering

by Malcolm Gladwell  · 1 Oct 2024  · 283pp  · 85,644 words

Hype: How Scammers, Grifters, and Con Artists Are Taking Over the Internet―and Why We're Following

by Gabrielle Bluestone  · 5 Apr 2021  · 329pp  · 100,162 words

Viruses: A Very Short Introduction (Very Short Introductions)

by Crawford, Dorothy H.  · 27 Jul 2011  · 161pp  · 37,042 words

The Long Game: China's Grand Strategy to Displace American Order

by Rush Doshi  · 24 Jun 2021  · 816pp  · 191,889 words

Poverty for Profit

by Anne Kim  · 384pp  · 112,825 words

Cabin Fever: The Harrowing Journey of a Cruise Ship at the Dawn of a Pandemic

by Michael Smith and Jonathan Franklin  · 14 Jul 2022  · 244pp  · 78,238 words

Abundance

by Ezra Klein and Derek Thompson  · 18 Mar 2025  · 227pp  · 84,566 words

Digital Empires: The Global Battle to Regulate Technology

by Anu Bradford  · 25 Sep 2023  · 898pp  · 236,779 words

Binge Times: Inside Hollywood's Furious Billion-Dollar Battle to Take Down Netflix

by Dade Hayes and Dawn Chmielewski  · 18 Apr 2022  · 414pp  · 117,581 words

The Contrarian: Peter Thiel and Silicon Valley's Pursuit of Power

by Max Chafkin  · 14 Sep 2021  · 524pp  · 130,909 words

Exponential: How Accelerating Technology Is Leaving Us Behind and What to Do About It

by Azeem Azhar  · 6 Sep 2021  · 447pp  · 111,991 words

Editing Humanity: The CRISPR Revolution and the New Era of Genome Editing

by Kevin Davies  · 5 Oct 2020  · 741pp  · 164,057 words

The Chaos Machine: The Inside Story of How Social Media Rewired Our Minds and Our World

by Max Fisher  · 5 Sep 2022  · 439pp  · 131,081 words

Sandy Hook: An American Tragedy and the Battle for Truth

by Elizabeth Williamson  · 8 Mar 2022  · 574pp  · 148,233 words

The Great Wave: The Era of Radical Disruption and the Rise of the Outsider

by Michiko Kakutani  · 20 Feb 2024  · 262pp  · 69,328 words

Shape: The Hidden Geometry of Information, Biology, Strategy, Democracy, and Everything Else

by Jordan Ellenberg  · 14 May 2021  · 665pp  · 159,350 words

This Land: The Struggle for the Left

by Owen Jones  · 23 Sep 2020  · 387pp  · 123,237 words

The Tyranny of Merit: What’s Become of the Common Good?

by Michael J. Sandel  · 9 Sep 2020  · 493pp  · 98,982 words

The Perfect Police State: An Undercover Odyssey Into China's Terrifying Surveillance Dystopia of the Future

by Geoffrey Cain  · 28 Jun 2021  · 340pp  · 90,674 words

Everyday Utopia: What 2,000 Years of Wild Experiments Can Teach Us About the Good Life

by Kristen R. Ghodsee  · 16 May 2023  · 302pp  · 112,390 words

Sunbelt Blues: The Failure of American Housing

by Andrew Ross  · 25 Oct 2021  · 301pp  · 90,276 words

Our Lives in Their Portfolios: Why Asset Managers Own the World

by Brett Chistophers  · 25 Apr 2023  · 404pp  · 106,233 words

The Atlas of Disease

by Sandra Hempel  · 15 Sep 2018

Paved Paradise: How Parking Explains the World

by Henry Grabar  · 8 May 2023  · 413pp  · 115,274 words

Billionaire, Nerd, Savior, King: Bill Gates and His Quest to Shape Our World

by Anupreeta Das  · 12 Aug 2024  · 315pp  · 115,894 words

AI 2041: Ten Visions for Our Future

by Kai-Fu Lee and Qiufan Chen  · 13 Sep 2021

The Wisdom of Crowds

by James Surowiecki  · 1 Jan 2004  · 326pp  · 106,053 words

The New Nomads: How the Migration Revolution Is Making the World a Better Place

by Felix Marquardt  · 7 Jul 2021  · 250pp  · 75,151 words

We're Not Broken: Changing the Autism Conversation

by Eric Garcia  · 2 Aug 2021  · 398pp  · 96,909 words

How to Read Numbers: A Guide to Statistics in the News (And Knowing When to Trust Them)

by Tom Chivers and David Chivers  · 18 Mar 2021  · 172pp  · 51,837 words

Please Don't Sit on My Bed in Your Outside Clothes: Essays

by Phoebe Robinson  · 14 Oct 2021  · 265pp  · 93,354 words

How Boards Work: And How They Can Work Better in a Chaotic World

by Dambisa Moyo  · 3 May 2021  · 272pp  · 76,154 words

How to Work Without Losing Your Mind

by Cate Sevilla  · 14 Jan 2021

Trading at the Speed of Light: How Ultrafast Algorithms Are Transforming Financial Markets

by Donald MacKenzie  · 24 May 2021  · 400pp  · 121,988 words

This Book Could Fix Your Life: The Science of Self Help

by New Scientist and Helen Thomson  · 7 Jan 2021  · 442pp  · 85,640 words

The London Problem: What Britain Gets Wrong About Its Capital City

by Jack Brown  · 14 Jul 2021  · 101pp  · 24,949 words

The Identity Trap: A Story of Ideas and Power in Our Time

by Yascha Mounk  · 26 Sep 2023

Survival of the Richest: Escape Fantasies of the Tech Billionaires

by Douglas Rushkoff  · 7 Sep 2022  · 205pp  · 61,903 words

Battle for the Bird: Jack Dorsey, Elon Musk, and the $44 Billion Fight for Twitter's Soul

by Kurt Wagner  · 20 Feb 2024  · 332pp  · 127,754 words

Tomorrow's Capitalist: My Search for the Soul of Business

by Alan Murray  · 15 Dec 2022  · 263pp  · 77,786 words

Shocks, Crises, and False Alarms: How to Assess True Macroeconomic Risk

by Philipp Carlsson-Szlezak and Paul Swartz  · 8 Jul 2024  · 259pp  · 89,637 words

American Marxism

by Mark R. Levin  · 12 Jul 2021  · 314pp  · 88,524 words

Less Is More: How Degrowth Will Save the World

by Jason Hickel  · 12 Aug 2020  · 286pp  · 87,168 words

Evil Geniuses: The Unmaking of America: A Recent History

by Kurt Andersen  · 14 Sep 2020  · 486pp  · 150,849 words

The Story of Work: A New History of Humankind

by Jan Lucassen  · 26 Jul 2021  · 869pp  · 239,167 words

Open: The Story of Human Progress

by Johan Norberg  · 14 Sep 2020  · 505pp  · 138,917 words

Buy Now, Pay Later: The Extraordinary Story of Afterpay

by Jonathan Shapiro and James Eyers  · 2 Aug 2021  · 444pp  · 124,631 words

You've Been Played: How Corporations, Governments, and Schools Use Games to Control Us All

by Adrian Hon  · 14 Sep 2022  · 371pp  · 107,141 words

The Mutant Project: Inside the Global Race to Genetically Modify Humans

by Eben Kirksey  · 10 Nov 2020  · 599pp  · 98,564 words

Summer of Our Discontent: The Age of Certainty and the Demise of Discourse

by Thomas Chatterton Williams  · 4 Aug 2025  · 242pp  · 76,315 words

How Medicine Works and When It Doesn't: Learning Who to Trust to Get and Stay Healthy

by F. Perry Wilson  · 24 Jan 2023  · 286pp  · 92,521 words

May Contain Lies: How Stories, Statistics, and Studies Exploit Our Biases—And What We Can Do About It

by Alex Edmans  · 13 May 2024  · 315pp  · 87,035 words

Moon Prague, Vienna & Budapest: Palaces & Castles, Art & Music, Coffeehouses & Beer Gardens

by Jennifer D Walker, Auburn Scallon and Moon Travel Guides  · 15 Oct 2024  · 806pp  · 221,571 words

On the Edge: The Art of Risking Everything

by Nate Silver  · 12 Aug 2024  · 848pp  · 227,015 words

The Authoritarian Moment: How the Left Weaponized America's Institutions Against Dissent

by Ben Shapiro  · 26 Jul 2021  · 309pp  · 81,243 words

Carmageddon: How Cars Make Life Worse and What to Do About It

by Daniel Knowles  · 27 Mar 2023  · 278pp  · 91,332 words

Human Frontiers: The Future of Big Ideas in an Age of Small Thinking

by Michael Bhaskar  · 2 Nov 2021

Ageless: The New Science of Getting Older Without Getting Old

by Andrew Steele  · 24 Dec 2020  · 399pp  · 118,576 words

Woke, Inc: Inside Corporate America's Social Justice Scam

by Vivek Ramaswamy  · 16 Aug 2021  · 344pp  · 104,522 words

A Hacker's Mind: How the Powerful Bend Society's Rules, and How to Bend Them Back

by Bruce Schneier  · 7 Feb 2023  · 306pp  · 82,909 words

Among the Braves: Hope, Struggle, and Exile in the Battle for Hong Kong and the Future of Global Democracy

by Shibani Mahtani and Timothy McLaughlin  · 7 Nov 2023  · 348pp  · 110,533 words

The Singularity Is Nearer: When We Merge with AI

by Ray Kurzweil  · 25 Jun 2024

The Price of Life: In Search of What We're Worth and Who Decides

by Jenny Kleeman  · 13 Mar 2024  · 334pp  · 96,342 words

Nobody's Fool: Why We Get Taken in and What We Can Do About It

by Daniel Simons and Christopher Chabris  · 10 Jul 2023  · 338pp  · 104,815 words

Framers: Human Advantage in an Age of Technology and Turmoil

by Kenneth Cukier, Viktor Mayer-Schönberger and Francis de Véricourt  · 10 May 2021  · 291pp  · 80,068 words

This Is How They Tell Me the World Ends: The Cyberweapons Arms Race

by Nicole Perlroth  · 9 Feb 2021  · 651pp  · 186,130 words

Culture Warlords: My Journey Into the Dark Web of White Supremacy

by Talia Lavin  · 14 Jul 2020  · 231pp  · 71,299 words

Raising Lazarus: Hope, Justice, and the Future of America’s Overdose Crisis

by Beth Macy  · 15 Aug 2022  · 389pp  · 111,372 words

The Great Post Office Scandal: The Fight to Expose a Multimillion Pound Scandal Which Put Innocent People in Jail

by Nick Wallis  · 18 Nov 2021  · 705pp  · 192,650 words

Practical Doomsday: A User's Guide to the End of the World

by Michal Zalewski  · 11 Jan 2022  · 337pp  · 96,666 words

Off the Edge: Flat Earthers, Conspiracy Culture, and Why People Will Believe Anything

by Kelly Weill  · 22 Feb 2022

Spies, Lies, and Algorithms: The History and Future of American Intelligence

by Amy B. Zegart  · 6 Nov 2021

New Laws of Robotics: Defending Human Expertise in the Age of AI

by Frank Pasquale  · 14 May 2020  · 1,172pp  · 114,305 words

The Raging 2020s: Companies, Countries, People - and the Fight for Our Future

by Alec Ross  · 13 Sep 2021  · 363pp  · 109,077 words

The Impossible City: A Hong Kong Memoir

by Karen Cheung  · 15 Feb 2022  · 297pp  · 96,945 words

Remote Work Revolution: Succeeding From Anywhere

by Tsedal Neeley  · 14 Oct 2021  · 223pp  · 60,936 words

Cogs and Monsters: What Economics Is, and What It Should Be

by Diane Coyle  · 11 Oct 2021  · 305pp  · 75,697 words

The Chairman's Lounge: The inside story of how Qantas sold us out

by Joe Aston  · 27 Oct 2024  · 362pp  · 130,141 words

The Great Demographic Reversal: Ageing Societies, Waning Inequality, and an Inflation Revival

by Charles Goodhart and Manoj Pradhan  · 8 Aug 2020  · 438pp  · 84,256 words

A Brief History of Motion: From the Wheel, to the Car, to What Comes Next

by Tom Standage  · 16 Aug 2021  · 290pp  · 85,847 words

Welcome to Britain: Fixing Our Broken Immigration System

by Colin Yeo;  · 15 Feb 2020  · 393pp  · 102,801 words

Decoding the World: A Roadmap for the Questioner

by Po Bronson  · 14 Jul 2020  · 320pp  · 95,629 words

The Powerful and the Damned: Private Diaries in Turbulent Times

by Lionel Barber  · 5 Nov 2020

Who’s Raising the Kids?: Big Tech, Big Business, and the Lives of Children

by Susan Linn  · 12 Sep 2022  · 415pp  · 102,982 words

Wasteland: The Dirty Truth About What We Throw Away, Where It Goes, and Why It Matters

by Oliver Franklin-Wallis  · 21 Jun 2023  · 309pp  · 121,279 words

Sickening: How Big Pharma Broke American Health Care and How We Can Repair It

by John Abramson  · 15 Dec 2022  · 362pp  · 97,473 words

Four Thousand Weeks: Time Management for Mortals

by Oliver Burkeman  · 9 Aug 2021  · 206pp  · 68,757 words

The Price Is Wrong: Why Capitalism Won't Save the Planet

by Brett Christophers  · 12 Mar 2024  · 557pp  · 154,324 words

Doppelganger: A Trip Into the Mirror World

by Naomi Klein  · 11 Sep 2023

The Power Law: Venture Capital and the Making of the New Future

by Sebastian Mallaby  · 1 Feb 2022  · 935pp  · 197,338 words

San Fransicko: Why Progressives Ruin Cities

by Michael Shellenberger  · 11 Oct 2021  · 572pp  · 124,222 words

Caste: The Origins of Our Discontents

by Isabel Wilkerson  · 14 Sep 2020  · 470pp  · 137,882 words

The Politics Industry: How Political Innovation Can Break Partisan Gridlock and Save Our Democracy

by Katherine M. Gehl and Michael E. Porter  · 14 Sep 2020  · 627pp  · 89,295 words

Laziness Does Not Exist

by Devon Price  · 5 Jan 2021  · 362pp  · 87,462 words

The Pyramid of Lies: Lex Greensill and the Billion-Dollar Scandal

by Duncan Mavin  · 20 Jul 2022  · 345pp  · 100,989 words

No One Succeeds Alone

by Robert Reffkin  · 4 May 2021  · 210pp  · 62,278 words

Happy-Go-Lucky

by David Sedaris  · 30 May 2022  · 206pp  · 64,212 words

The Nowhere Office: Reinventing Work and the Workplace of the Future

by Julia Hobsbawm  · 11 Apr 2022  · 172pp  · 50,777 words

The Ransomware Hunting Team: A Band of Misfits' Improbable Crusade to Save the World From Cybercrime

by Renee Dudley and Daniel Golden  · 24 Oct 2022  · 392pp  · 114,189 words

The Great Influenza: The Story of the Deadliest Pandemic in History

by John M. Barry  · 9 Feb 2004  · 667pp  · 186,968 words

The Heat Will Kill You First: Life and Death on a Scorched Planet

by Jeff Goodell  · 10 Jul 2023  · 347pp  · 108,323 words

The Rise and Fall of the Neoliberal Order: America and the World in the Free Market Era

by Gary Gerstle  · 14 Oct 2022  · 655pp  · 156,367 words

This Is Not Normal: The Collapse of Liberal Britain

by William Davies  · 28 Sep 2020  · 210pp  · 65,833 words

Capitalism and Its Critics: A History: From the Industrial Revolution to AI

by John Cassidy  · 12 May 2025  · 774pp  · 238,244 words

There Is No Place for Us: Working and Homeless in America

by Brian Goldstone  · 25 Mar 2025  · 512pp  · 153,059 words

Bootstrapped: Liberating Ourselves From the American Dream

by Alissa Quart  · 14 Mar 2023  · 304pp  · 86,028 words

Vassal State

by Angus Hanton  · 25 Mar 2024  · 277pp  · 81,718 words

Code Dependent: Living in the Shadow of AI

by Madhumita Murgia  · 20 Mar 2024  · 336pp  · 91,806 words

The Constitution of Knowledge: A Defense of Truth

by Jonathan Rauch  · 21 Jun 2021  · 446pp  · 109,157 words

I, Warbot: The Dawn of Artificially Intelligent Conflict

by Kenneth Payne  · 16 Jun 2021  · 339pp  · 92,785 words

System Error: Where Big Tech Went Wrong and How We Can Reboot

by Rob Reich, Mehran Sahami and Jeremy M. Weinstein  · 6 Sep 2021

100 Things We've Lost to the Internet

by Pamela Paul  · 14 Oct 2021  · 194pp  · 54,355 words

Lessons from the Titans: What Companies in the New Economy Can Learn from the Great Industrial Giants to Drive Sustainable Success

by Scott Davis, Carter Copeland and Rob Wertheimer  · 13 Jul 2020  · 372pp  · 101,678 words

Trumpocalypse: Restoring American Democracy

by David Frum  · 25 May 2020  · 319pp  · 75,257 words

Power Play: Tesla, Elon Musk, and the Bet of the Century

by Tim Higgins  · 2 Aug 2021  · 430pp  · 135,418 words

Life's Edge: The Search for What It Means to Be Alive

by Carl Zimmer  · 9 Mar 2021  · 392pp  · 109,945 words

As Gods: A Moral History of the Genetic Age

by Matthew Cobb  · 15 Nov 2022  · 772pp  · 150,109 words

How to Stand Up to a Dictator

by Maria Ressa  · 19 Oct 2022

The Loop: How Technology Is Creating a World Without Choices and How to Fight Back

by Jacob Ward  · 25 Jan 2022  · 292pp  · 94,660 words

SEDATED: How Modern Capitalism Created Our Mental Health Crisis

by James. Davies  · 15 Nov 2021  · 307pp  · 88,085 words

Power, for All: How It Really Works and Why It's Everyone's Business

by Julie Battilana and Tiziana Casciaro  · 30 Aug 2021  · 345pp  · 92,063 words

Beyond Diversification: What Every Investor Needs to Know About Asset Allocation

by Sebastien Page  · 4 Nov 2020  · 367pp  · 97,136 words

Owning the Sun

by Alexander Zaitchik  · 7 Jan 2022  · 341pp  · 98,954 words

Aiming High: Masayoshi Son, SoftBank, and Disrupting Silicon Valley

by Atsuo Inoue  · 18 Nov 2021  · 295pp  · 89,441 words

Unthinkable: Trauma, Truth, and the Trials of American Democracy

by Jamie Raskin  · 4 Jan 2022  · 450pp  · 144,939 words

Moon Portugal

by Carrie-Marie Bratley  · 15 Mar 2021  · 743pp  · 193,663 words

Automation and the Future of Work

by Aaron Benanav  · 3 Nov 2020  · 175pp  · 45,815 words

The Geek Way: The Radical Mindset That Drives Extraordinary Results

by Andrew McAfee  · 14 Nov 2023  · 381pp  · 113,173 words

The Fund: Ray Dalio, Bridgewater Associates, and the Unraveling of a Wall Street Legend

by Rob Copeland  · 7 Nov 2023  · 412pp  · 122,655 words

On Breathing

by Jamieson Webster  · 20 Feb 2025  · 198pp  · 63,059 words

Uncomfortably Off: Why the Top 10% of Earners Should Care About Inequality

by Marcos González Hernando and Gerry Mitchell  · 23 May 2023

The Great Displacement: Climate Change and the Next American Migration

by Jake Bittle  · 21 Feb 2023  · 296pp  · 118,126 words

When McKinsey Comes to Town: The Hidden Influence of the World's Most Powerful Consulting Firm

by Walt Bogdanich and Michael Forsythe  · 3 Oct 2022  · 689pp  · 134,457 words

Like, Comment, Subscribe: Inside YouTube's Chaotic Rise to World Domination

by Mark Bergen  · 5 Sep 2022  · 642pp  · 141,888 words

Inventor of the Future: The Visionary Life of Buckminster Fuller

by Alec Nevala-Lee  · 1 Aug 2022  · 864pp  · 222,565 words

The Dark Cloud: How the Digital World Is Costing the Earth

by Guillaume Pitron  · 14 Jun 2023  · 271pp  · 79,355 words

Sparks: China's Underground Historians and Their Battle for the Future

by Ian Johnson  · 26 Sep 2023  · 407pp  · 119,073 words

Chokepoints: American Power in the Age of Economic Warfare

by Edward Fishman  · 25 Feb 2025  · 884pp  · 221,861 words

Life as We Made It: How 50,000 Years of Human Innovation Refined--And Redefined--Nature

by Beth Shapiro  · 15 Dec 2021  · 338pp  · 105,112 words

And Finally

by Henry Marsh  · 167pp  · 57,175 words

Failed State: The Sunday Times Bestselling Investigation Into Why Britain Is Struggling

by Sam Freedman  · 10 Jul 2024  · 368pp  · 101,133 words

A Hunter-Gatherer's Guide to the 21st Century: Evolution and the Challenges of Modern Life

by Heather Heying and Bret Weinstein  · 14 Sep 2021  · 384pp  · 105,110 words

Rich White Men: What It Takes to Uproot the Old Boys' Club and Transform America

by Garrett Neiman  · 19 Jun 2023  · 386pp  · 112,064 words

Moon Mexico City: Neighborhood Walks, Food & Culture, Beloved Local Spots

by Julie Meade  · 7 Aug 2023  · 527pp  · 131,002 words

The Trauma Chronicles

by Westaby, Stephen  · 1 Feb 2023

The Genetic Lottery: Why DNA Matters for Social Equality

by Kathryn Paige Harden  · 20 Sep 2021  · 375pp  · 102,166 words

Rationality: What It Is, Why It Seems Scarce, Why It Matters

by Steven Pinker  · 14 Oct 2021  · 533pp  · 125,495 words

Fallen Idols: Twelve Statues That Made History

by Alex von Tunzelmann  · 7 Jul 2021  · 337pp  · 87,236 words

MegaThreats: Ten Dangerous Trends That Imperil Our Future, and How to Survive Them

by Nouriel Roubini  · 17 Oct 2022  · 328pp  · 96,678 words

Fancy Bear Goes Phishing: The Dark History of the Information Age, in Five Extraordinary Hacks

by Scott J. Shapiro  · 523pp  · 154,042 words

The Capitalist Manifesto

by Johan Norberg  · 14 Jun 2023  · 295pp  · 87,204 words

Scary Smart: The Future of Artificial Intelligence and How You Can Save Our World

by Mo Gawdat  · 29 Sep 2021  · 259pp  · 84,261 words

An Ugly Truth: Inside Facebook's Battle for Domination

by Sheera Frenkel and Cecilia Kang  · 12 Jul 2021  · 372pp  · 100,947 words

How to Avoid a Climate Disaster: The Solutions We Have and the Breakthroughs We Need

by Bill Gates  · 16 Feb 2021  · 314pp  · 75,678 words

Cathedrals of Steam: How London’s Great Stations Were Built – and How They Transformed the City

by Christian Wolmar  · 5 Nov 2020  · 352pp  · 98,424 words

The Cult of We: WeWork, Adam Neumann, and the Great Startup Delusion

by Eliot Brown and Maureen Farrell  · 19 Jul 2021  · 460pp  · 130,820 words

What We Owe the Future: A Million-Year View

by William MacAskill  · 31 Aug 2022  · 451pp  · 125,201 words

Your Face Belongs to Us: A Secretive Startup's Quest to End Privacy as We Know It

by Kashmir Hill  · 19 Sep 2023  · 487pp  · 124,008 words

Growth: A Reckoning

by Daniel Susskind  · 16 Apr 2024  · 358pp  · 109,930 words

Fear Is Just a Word: A Missing Daughter, a Violent Cartel, and a Mother's Quest for Vengeance

by Azam Ahmed  · 26 Sep 2023  · 483pp  · 129,263 words

Still Broke: Walmart's Remarkable Transformation and the Limits of Socially Conscious Capitalism

by Rick Wartzman  · 15 Nov 2022  · 215pp  · 69,370 words

Recoding America: Why Government Is Failing in the Digital Age and How We Can Do Better

by Jennifer Pahlka  · 12 Jun 2023  · 288pp  · 96,204 words

How Big Things Get Done: The Surprising Factors Behind Every Successful Project, From Home Renovations to Space Exploration

by Bent Flyvbjerg and Dan Gardner  · 16 Feb 2023  · 353pp  · 97,029 words

Slow Productivity: The Lost Art of Accomplishment Without Burnout

by Cal Newport  · 5 Mar 2024  · 233pp  · 65,893 words

Planes, Trains and Toilet Doors: 50 Places That Changed British Politics

by Matt Chorley  · 8 Feb 2024  · 254pp  · 75,897 words

The Science of Hate: How Prejudice Becomes Hate and What We Can Do to Stop It

by Matthew Williams  · 23 Mar 2021  · 592pp  · 125,186 words

Character Limit: How Elon Musk Destroyed Twitter

by Kate Conger and Ryan Mac  · 17 Sep 2024

Fluke: Chance, Chaos, and Why Everything We Do Matters

by Brian Klaas  · 23 Jan 2024  · 250pp  · 96,870 words

Fortune's Bazaar: the Making of Hong Kong: The Making of Hong Kong

by Vaudine England  · 16 May 2023  · 308pp  · 122,100 words

Extremely Hardcore: Inside Elon Musk's Twitter

by Zoë Schiffer  · 13 Feb 2024  · 343pp  · 92,693 words

Crack-Up Capitalism: Market Radicals and the Dream of a World Without Democracy

by Quinn Slobodian  · 4 Apr 2023  · 360pp  · 107,124 words

Gambling Man

by Lionel Barber  · 3 Oct 2024  · 424pp  · 123,730 words

One Billion Americans: The Case for Thinking Bigger

by Matthew Yglesias  · 14 Sep 2020

Flying Blind: The 737 MAX Tragedy and the Fall of Boeing

by Peter Robison  · 29 Nov 2021  · 382pp  · 105,657 words

Career and Family: Women’s Century-Long Journey Toward Equity

by Claudia Goldin  · 11 Oct 2021  · 445pp  · 122,877 words

The Greek Revolution: 1821 and the Making of Modern Europe

by Mark Mazower  · 4 Nov 2021  · 887pp  · 242,125 words

100 Years of Identity Crisis: Culture War Over Socialisation

by Frank Furedi  · 6 Sep 2021  · 535pp  · 103,761 words

Age of the City: Why Our Future Will Be Won or Lost Together

by Ian Goldin and Tom Lee-Devlin  · 21 Jun 2023  · 248pp  · 73,689 words

The Coming Wave: Technology, Power, and the Twenty-First Century's Greatest Dilemma

by Mustafa Suleyman  · 4 Sep 2023  · 444pp  · 117,770 words

Unit X: How the Pentagon and Silicon Valley Are Transforming the Future of War

by Raj M. Shah and Christopher Kirchhoff  · 8 Jul 2024  · 272pp  · 103,638 words

Trillions: How a Band of Wall Street Renegades Invented the Index Fund and Changed Finance Forever

by Robin Wigglesworth  · 11 Oct 2021  · 432pp  · 106,612 words

The Bookshop: A History of the American Bookstore

by Evan Friss  · 5 Aug 2024  · 493pp  · 120,793 words

Power and Progress: Our Thousand-Year Struggle Over Technology and Prosperity

by Daron Acemoglu and Simon Johnson  · 15 May 2023  · 619pp  · 177,548 words

Super Founders: What Data Reveals About Billion-Dollar Startups

by Ali Tamaseb  · 14 Sep 2021  · 251pp  · 80,831 words

The Emperor's New Road: How China's New Silk Road Is Remaking the World

by Jonathan Hillman  · 28 Sep 2020  · 388pp  · 99,023 words

Sustainable Minimalism: Embrace Zero Waste, Build Sustainability Habits That Last, and Become a Minimalist Without Sacrificing the Planet (Green Housecleaning, Zero Waste Living)

by Stephanie Marie Seferian  · 19 Jan 2021

Apocalypse Never: Why Environmental Alarmism Hurts Us All

by Michael Shellenberger  · 28 Jun 2020

The Pay Off: How Changing the Way We Pay Changes Everything

by Gottfried Leibbrandt and Natasha de Teran  · 14 Jul 2021  · 326pp  · 91,532 words

Mine!: How the Hidden Rules of Ownership Control Our Lives

by Michael A. Heller and James Salzman  · 2 Mar 2021  · 332pp  · 100,245 words

Science Fictions: How Fraud, Bias, Negligence, and Hype Undermine the Search for Truth

by Stuart Ritchie  · 20 Jul 2020

Curbing Traffic: The Human Case for Fewer Cars in Our Lives

by Chris Bruntlett and Melissa Bruntlett  · 28 Jun 2021  · 225pp  · 70,590 words

Transport for Humans: Are We Nearly There Yet?

by Pete Dyson and Rory Sutherland  · 15 Jan 2021  · 342pp  · 72,927 words

Chokepoint Capitalism

by Rebecca Giblin and Cory Doctorow  · 26 Sep 2022  · 396pp  · 113,613 words

Under a White Sky: The Nature of the Future

by Elizabeth Kolbert  · 15 Mar 2021  · 221pp  · 59,755 words

12 Bytes: How We Got Here. Where We Might Go Next

by Jeanette Winterson  · 15 Mar 2021  · 256pp  · 73,068 words

A Short History of Humanity: How Migration Made Us Who We Are

by Johannes Krause and Thomas Trappe  · 8 Apr 2021  · 218pp  · 62,621 words

Nuts and Bolts: Seven Small Inventions That Changed the World (In a Big Way)

by Roma Agrawal  · 2 Mar 2023  · 290pp  · 80,461 words

Visual Thinking: The Hidden Gifts of People Who Think in Pictures, Patterns, and Abstractions

by Temple Grandin, Ph.d.  · 11 Oct 2022

Capital Allocators: How the World’s Elite Money Managers Lead and Invest

by Ted Seides  · 23 Mar 2021  · 199pp  · 48,162 words

Can We Talk About Israel?: A Guide for the Curious, Confused, and Conflicted

by Daniel Sokatch  · 18 Oct 2021  · 556pp  · 95,955 words

Cheap Land Colorado: Off-Gridders at America's Edge

by Ted Conover  · 1 Nov 2022  · 391pp  · 106,255 words

Dead in the Water: A True Story of Hijacking, Murder, and a Global Maritime Conspiracy

by Matthew Campbell and Kit Chellel  · 2 May 2022  · 363pp  · 98,496 words

Badvertising

by Andrew Simms  · 314pp  · 81,529 words

Restarting the Future: How to Fix the Intangible Economy

by Jonathan Haskel and Stian Westlake  · 4 Apr 2022  · 338pp  · 85,566 words

Insight Guides Iceland

by Insight Guides  · 6 Dec 2024  · 415pp  · 110,831 words

The Shame Machine: Who Profits in the New Age of Humiliation

by Cathy O'Neil  · 15 Mar 2022  · 318pp  · 73,713 words

Emotional Labor: The Invisible Work Shaping Our Lives and How to Claim Our Power

by Rose Hackman  · 27 Mar 2023

The Great Experiment: Why Diverse Democracies Fall Apart and How They Can Endure

by Yascha Mounk  · 19 Apr 2022  · 442pp  · 112,155 words

Not the End of the World

by Hannah Ritchie  · 9 Jan 2024  · 335pp  · 101,992 words

Gilded Rage: Elon Musk and the Radicalization of Silicon Valley

by Jacob Silverman  · 9 Oct 2025  · 312pp  · 103,645 words

Mood Machine: The Rise of Spotify and the Costs of the Perfect Playlist

by Liz Pelly  · 7 Jan 2025  · 293pp  · 104,461 words

Samuelson Friedman: The Battle Over the Free Market

by Nicholas Wapshott  · 2 Aug 2021  · 453pp  · 122,586 words

Tory Nation: The Dark Legacy of the World's Most Successful Political Party

by Samuel Earle  · 3 May 2023  · 245pp  · 88,158 words

Nexus: A Brief History of Information Networks From the Stone Age to AI

by Yuval Noah Harari  · 9 Sep 2024  · 566pp  · 169,013 words

Elon Musk

by Walter Isaacson  · 11 Sep 2023  · 562pp  · 201,502 words

Cities in the Sky: The Quest to Build the World's Tallest Skyscrapers

by Jason M. Barr  · 13 May 2024  · 292pp  · 107,998 words

The Power of Geography: Ten Maps That Reveal the Future of Our World

by Tim Marshall  · 14 Oct 2021  · 383pp  · 105,387 words

Lonely Planet Wales

by Anna Kaminski;Hugh McNaughtan  · 640pp  · 160,013 words

Belgium - Culture Smart!: The Essential Guide to Customs & Culture

by Bernadett Varga  · 14 Aug 2022

How Elites Ate the Social Justice Movement

by Fredrik Deboer  · 4 Sep 2023  · 211pp  · 78,547 words

Lonely Planet Peru

by Lonely Planet  · 1,166pp  · 301,688 words

A World on the Wing: The Global Odyssey of Migratory Birds

by Scott Weidensaul  · 29 Mar 2021  · 415pp  · 136,343 words

Blood and Oil: Mohammed Bin Salman's Ruthless Quest for Global Power

by Bradley Hope and Justin Scheck  · 14 Sep 2020  · 339pp  · 103,546 words

The Next Shift: The Fall of Industry and the Rise of Health Care in Rust Belt America

by Gabriel Winant  · 23 Mar 2021  · 563pp  · 136,190 words

If Then: How Simulmatics Corporation Invented the Future

by Jill Lepore  · 14 Sep 2020  · 467pp  · 149,632 words

Spooked: The Trump Dossier, Black Cube, and the Rise of Private Spies

by Barry Meier  · 17 May 2021  · 319pp  · 89,192 words

Midnight in Vehicle City: General Motors, Flint, and the Strike That Created the Middle Class

by Edward McClelland  · 2 Feb 2021  · 264pp  · 74,785 words

Net Zero: How We Stop Causing Climate Change

by Dieter Helm  · 2 Sep 2020  · 304pp  · 90,084 words

GDP: The World’s Most Powerful Formula and Why It Must Now Change

by Ehsan Masood  · 4 Mar 2021  · 303pp  · 74,206 words

Futureproof: 9 Rules for Humans in the Age of Automation

by Kevin Roose  · 9 Mar 2021  · 208pp  · 57,602 words

Empire of Pain: The Secret History of the Sackler Dynasty

by Patrick Radden Keefe  · 12 Apr 2021  · 712pp  · 212,334 words

The Ages of Globalization

by Jeffrey D. Sachs  · 2 Jun 2020

Together

by Vivek H. Murthy, M.D.  · 5 Mar 2020  · 405pp  · 112,470 words

When More Is Not Better: Overcoming America's Obsession With Economic Efficiency

by Roger L. Martin  · 28 Sep 2020  · 600pp  · 72,502 words

Not Working: Where Have All the Good Jobs Gone?

by David G. Blanchflower  · 12 Apr 2021  · 566pp  · 160,453 words

Bill Bailey's Remarkable Guide to Happiness: THE FEELGOOD BOOK OF THE YEAR

by Bill Bailey  · 14 Oct 2020  · 112pp  · 34,520 words

Python for Algorithmic Trading: From Idea to Cloud Deployment

by Yves Hilpisch  · 8 Dec 2020  · 1,082pp  · 87,792 words

Work: A History of How We Spend Our Time

by James Suzman  · 2 Sep 2020  · 909pp  · 130,170 words

Women and Other Monsters: Building a New Mythology

by Jess Zimmerman  · 9 Mar 2021  · 224pp  · 74,019 words

Cultish: The Language of Fanaticism

by Amanda Montell  · 14 Jun 2021  · 244pp  · 73,700 words

The Science and Technology of Growing Young: An Insider's Guide to the Breakthroughs That Will Dramatically Extend Our Lifespan . . . And What You Can Do Right Now

by Sergey Young  · 23 Aug 2021  · 326pp  · 88,968 words

Death Glitch: How Techno-Solutionism Fails Us in This Life and Beyond

by Tamara Kneese  · 14 Aug 2023  · 284pp  · 75,744 words

Fodor's Essential Israel

by Fodor's Travel Guides  · 2 Aug 2023  · 695pp  · 189,074 words

The New Snobbery

by David Skelton  · 28 Jun 2021  · 226pp  · 58,341 words

The Star Builders: Nuclear Fusion and the Race to Power the Planet

by Arthur Turrell  · 2 Aug 2021  · 297pp  · 84,447 words

The Key Man: The True Story of How the Global Elite Was Duped by a Capitalist Fairy Tale

by Simon Clark and Will Louch  · 14 Jul 2021  · 403pp  · 105,550 words

Number Go Up: Inside Crypto's Wild Rise and Staggering Fall

by Zeke Faux  · 11 Sep 2023  · 385pp  · 106,848 words

Palace Coup: The Billionaire Brawl Over the Bankrupt Caesars Gaming Empire

by Sujeet Indap and Max Frumes  · 16 Mar 2021  · 362pp  · 116,497 words

Numbers Don't Lie: 71 Stories to Help Us Understand the Modern World

by Vaclav Smil  · 4 May 2021  · 252pp  · 60,959 words

2034: A Novel of the Next World War

by Elliot Ackerman and James Admiral Stavridis  · 15 Mar 2021  · 297pp  · 89,292 words

Hope Dies Last: Visionary People Across the World, Fighting to Find Us a Future

by Alan Weisman  · 21 Apr 2025  · 599pp  · 149,014 words

Care: The Highest Stage of Capitalism

by Premilla Nadasen  · 10 Oct 2023  · 288pp  · 82,972 words

After Steve: How Apple Became a Trillion-Dollar Company and Lost Its Soul

by Tripp Mickle  · 2 May 2022  · 535pp  · 149,752 words

American Kleptocracy: How the U.S. Created the World's Greatest Money Laundering Scheme in History

by Casey Michel  · 23 Nov 2021  · 466pp  · 116,165 words

The Elements of Choice: Why the Way We Decide Matters

by Eric J. Johnson  · 12 Oct 2021  · 362pp  · 103,087 words

California Burning: The Fall of Pacific Gas and Electric--And What It Means for America's Power Grid

by Katherine Blunt  · 29 Aug 2022  · 470pp  · 107,074 words

The Crux

by Richard Rumelt  · 27 Apr 2022  · 363pp  · 109,834 words

Damsel in Distressed: My Life in the Golden Age of Hedge Funds

by Dominique Mielle  · 6 Sep 2021  · 195pp  · 63,455 words

The Passenger: Paris

by AA.VV.  · 26 Jun 2021  · 199pp  · 62,204 words

Flowers of Fire: The Inside Story of South Korea's Feminist Movement and What It Means for Women's Rights Worldwide

by Hawon Jung  · 21 Mar 2023  · 401pp  · 112,589 words

The Climate Book: The Facts and the Solutions

by Greta Thunberg  · 14 Feb 2023  · 651pp  · 162,060 words

The Revolution That Wasn't: GameStop, Reddit, and the Fleecing of Small Investors

by Spencer Jakab  · 1 Feb 2022  · 420pp  · 94,064 words

Routes to Rejoin

by Stay European  · 3 Oct 2021  · 940pp  · 16,301 words

More Everything Forever: AI Overlords, Space Empires, and Silicon Valley's Crusade to Control the Fate of Humanity

by Adam Becker  · 14 Jun 2025  · 381pp  · 119,533 words

Autism After the Pandemic: A Step by Step Guide to Successfully Transition Back to School and Work

by James Ball and Kristie Lofland  · 17 Aug 2020  · 26pp  · 5,240 words

The Equality Machine: Harnessing Digital Technology for a Brighter, More Inclusive Future

by Orly Lobel  · 17 Oct 2022  · 370pp  · 112,809 words

The War Came to Us: Life and Death in Ukraine

by Christopher Miller  · 17 Jul 2023  · 469pp  · 149,526 words

The Tyranny of Nostalgia: Half a Century of British Economic Decline

by Russell Jones  · 15 Jan 2023  · 463pp  · 140,499 words

Empty Vessel: The Story of the Global Economy in One Barge

by Ian Kumekawa  · 6 May 2025  · 422pp  · 112,638 words

The Undertow: Scenes From a Slow Civil War

by Jeff Sharlet  · 21 Mar 2023  · 308pp  · 97,480 words

Adriatic: A Concert of Civilizations at the End of the Modern Age

by Robert D. Kaplan  · 11 Apr 2022  · 500pp  · 115,119 words

Strength in Numbers: How Polls Work and Why We Need Them

by G. Elliott Morris  · 11 Jul 2022  · 252pp  · 71,176 words

The Alternative: How to Build a Just Economy

by Nick Romeo  · 15 Jan 2024  · 343pp  · 103,376 words

Jellyfish Age Backwards: Nature's Secrets to Longevity

by Nicklas Brendborg  · 17 Jan 2023  · 222pp  · 68,595 words

Not One Inch: America, Russia, and the Making of Post-Cold War Stalemate

by M. E. Sarotte  · 29 Nov 2021  · 791pp  · 222,536 words

Superbloom: How Technologies of Connection Tear Us Apart

by Nicholas Carr  · 28 Jan 2025  · 231pp  · 85,135 words

Strange Sally Diamond: A BBC Between the Covers Book Club Pick

by Liz Nugent  · 2 Mar 2023  · 355pp  · 103,988 words

Who Will Defend Europe?: An Awakened Russia and a Sleeping Continent

by Keir Giles  · 24 Oct 2024  · 296pp  · 81,440 words

Our Dollar, Your Problem: An Insider’s View of Seven Turbulent Decades of Global Finance, and the Road Ahead

by Kenneth Rogoff  · 27 Feb 2025  · 330pp  · 127,791 words

Money in the Metaverse: Digital Assets, Online Identities, Spatial Computing and Why Virtual Worlds Mean Real Business

by David G. W. Birch and Victoria Richardson  · 28 Apr 2024  · 249pp  · 74,201 words

City Limits: Infrastructure, Inequality, and the Future of America's Highways

by Megan Kimble  · 2 Apr 2024  · 430pp  · 117,211 words

I Deliver Parcels in Beijing

by Hu Anyan  · 240pp  · 83,473 words

The Antisocial Network: The GameStop Short Squeeze and the Ragtag Group of Amateur Traders That Brought Wall Street to Its Knees

by Ben Mezrich  · 6 Sep 2021  · 239pp  · 74,845 words

Attention Factory: The Story of TikTok and China's ByteDance

by Matthew Brennan  · 9 Oct 2020  · 282pp  · 63,385 words

Wanderers: A Novel

by Chuck Wendig  · 1 Jul 2019  · 1,028pp  · 267,392 words

The Rough Guide to Wales

by Rough Guides  · 14 Oct 2024  · 882pp  · 240,215 words

Last Best Hope: America in Crisis and Renewal

by George Packer  · 14 Jun 2021  · 173pp  · 55,328 words

The Library: A Fragile History

by Arthur Der Weduwen and Andrew Pettegree  · 14 Oct 2021  · 457pp  · 173,326 words

The Rough Guide to Australia (Travel Guide eBook)

by Rough Guides  · 14 Oct 2023  · 1,955pp  · 521,661 words

The Soul of Wealth

by Daniel Crosby  · 19 Sep 2024  · 229pp  · 73,085 words

Lonely Planet Belgium & Luxembourg

by Lonely Planet

The Quiet Coup: Neoliberalism and the Looting of America

by Mehrsa Baradaran  · 7 May 2024  · 470pp  · 158,007 words

Fodor's Essential Belgium

by Fodor's Travel Guides  · 23 Aug 2022

Morning After the Revolution: Dispatches From the Wrong Side of History

by Nellie Bowles  · 13 May 2024  · 207pp  · 62,397 words

Why Machines Learn: The Elegant Math Behind Modern AI

by Anil Ananthaswamy  · 15 Jul 2024  · 416pp  · 118,522 words

Generations: The Real Differences Between Gen Z, Millennials, Gen X, Boomers, and Silents—and What They Mean for America's Future

by Jean M. Twenge  · 25 Apr 2023  · 541pp  · 173,676 words

Boom: Bubbles and the End of Stagnation

by Byrne Hobart and Tobias Huber  · 29 Oct 2024  · 292pp  · 106,826 words

Invention: A Life

by James Dyson  · 6 Sep 2021  · 312pp  · 108,194 words

The Aristocracy of Talent: How Meritocracy Made the Modern World

by Adrian Wooldridge  · 2 Jun 2021  · 693pp  · 169,849 words

The Breakup Monologues: The Unexpected Joy of Heartbreak

by Rosie Wilby  · 26 May 2021  · 227pp  · 67,264 words

Devil Take the Hindmost: A History of Financial Speculation

by Edward Chancellor  · 31 May 2000  · 860pp  · 227,491 words

Why Startups Fail: A New Roadmap for Entrepreneurial Success

by Tom Eisenmann  · 29 Mar 2021  · 387pp  · 106,753 words

The Psychology of Money: Timeless Lessons on Wealth, Greed, and Happiness

by Morgan Housel  · 7 Sep 2020  · 209pp  · 53,175 words

Underwater: How Our American Dream of Homeownership Became a Nightmare

by Ryan Dezember  · 13 Jul 2020  · 279pp  · 87,875 words

Kleptopia: How Dirty Money Is Conquering the World

by Tom Burgis  · 7 Sep 2020  · 476pp  · 139,761 words

Too Much and Never Enough: How My Family Created the World's Most Dangerous Man

by Mary L. Trump  · 13 Jul 2020  · 269pp  · 72,752 words

America in the World: A History of U.S. Diplomacy and Foreign Policy

by Robert B. Zoellick  · 3 Aug 2020

The Knowledge Machine: How Irrationality Created Modern Science

by Michael Strevens  · 12 Oct 2020

Billion Dollar Loser: The Epic Rise and Spectacular Fall of Adam Neumann and WeWork

by Reeves Wiedeman  · 19 Oct 2020  · 303pp  · 100,516 words

The Heart of Business: Leadership Principles for the Next Era of Capitalism

by Hubert Joly  · 14 Jun 2021  · 265pp  · 75,202 words

The Musical Human: A History of Life on Earth

by Michael Spitzer  · 31 Mar 2021  · 632pp  · 163,143 words

The World Without Us

by Alan Weisman  · 5 Aug 2008  · 482pp  · 106,041 words

The Singularity Is Near: When Humans Transcend Biology

by Ray Kurzweil  · 14 Jul 2005  · 761pp  · 231,902 words

Global Catastrophic Risks

by Nick Bostrom and Milan M. Cirkovic  · 2 Jul 2008

It's Better Than It Looks: Reasons for Optimism in an Age of Fear

by Gregg Easterbrook  · 20 Feb 2018  · 424pp  · 119,679 words

Israel & the Palestinian Territories Travel Guide

by Lonely Planet

Alpha Trader

by Brent Donnelly  · 11 May 2021

The Pattern Seekers: How Autism Drives Human Invention

by Simon Baron-Cohen  · 14 Aug 2020

Kings of Crypto: One Startup's Quest to Take Cryptocurrency Out of Silicon Valley and Onto Wall Street

by Jeff John Roberts  · 15 Dec 2020  · 226pp  · 65,516 words

Built on a Lie: The Rise and Fall of Neil Woodford and the Fate of Middle England’s Money

by Owen Walker  · 4 Mar 2021  · 278pp  · 82,771 words

Money: The True Story of a Made-Up Thing

by Jacob Goldstein  · 14 Aug 2020  · 199pp  · 64,272 words

Zero to Sold: How to Start, Run, and Sell a Bootstrapped Business

by Arvid Kahl  · 24 Jun 2020  · 461pp  · 106,027 words

Mini Farming: Self-Sufficiency on 1/4 Acre

by Brett L. Markham  · 14 Apr 2010  · 252pp  · 73,387 words

Drunk: How We Sipped, Danced, and Stumbled Our Way to Civilization

by Edward Slingerland  · 31 May 2021

Working Backwards: Insights, Stories, and Secrets From Inside Amazon

by Colin Bryar and Bill Carr  · 9 Feb 2021  · 302pp  · 100,493 words

How I Invest My Money: Finance Experts Reveal How They Save, Spend, and Invest

by Brian Portnoy and Joshua Brown  · 17 Nov 2020  · 149pp  · 43,747 words

We Are Bellingcat: Global Crime, Online Sleuths, and the Bold Future of News

by Eliot Higgins  · 2 Mar 2021  · 277pp  · 70,506 words

Snakes and Ladders: The Great British Social Mobility Myth

by Selina Todd  · 11 Feb 2021  · 598pp  · 150,801 words

The Man Who Broke Capitalism: How Jack Welch Gutted the Heartland and Crushed the Soul of Corporate America—and How to Undo His Legacy

by David Gelles  · 30 May 2022  · 318pp  · 91,957 words

Being You: A New Science of Consciousness

by Anil Seth  · 29 Aug 2021  · 418pp  · 102,597 words

King Richard: Nixon and Watergate--An American Tragedy

by Michael Dobbs  · 24 May 2021  · 426pp  · 117,722 words

Inheritance

by Leo Hollis  · 334pp  · 103,106 words

Ask Your Developer: How to Harness the Power of Software Developers and Win in the 21st Century

by Jeff Lawson  · 12 Jan 2021  · 282pp  · 85,658 words

The Bond King: How One Man Made a Market, Built an Empire, and Lost It All

by Mary Childs  · 15 Mar 2022  · 367pp  · 110,161 words

Butler to the World: How Britain Became the Servant of Tycoons, Tax Dodgers, Kleptocrats and Criminals

by Oliver Bullough  · 10 Mar 2022  · 257pp  · 80,698 words

Data Action: Using Data for Public Good

by Sarah Williams  · 14 Sep 2020

Things That Matter: Overcoming Distraction to Pursue a More Meaningful Life

by Joshua Becker  · 19 Apr 2022  · 215pp  · 62,479 words

Pure Invention: How Japan's Pop Culture Conquered the World

by Matt Alt  · 14 Apr 2020

Internet for the People: The Fight for Our Digital Future

by Ben Tarnoff  · 13 Jun 2022  · 234pp  · 67,589 words

Working Identity, Updated Edition, With a New Preface: Unconventional Strategies for Reinventing Your Career

by Herminia Ibarra  · 17 Oct 2023  · 200pp  · 67,943 words

Underestimated: An Autism Miracle

by J. B. Handley and Jamison Handley  · 23 Mar 2021  · 130pp  · 42,093 words

Pandora's Box: How Guts, Guile, and Greed Upended TV

by Peter Biskind  · 6 Nov 2023  · 543pp  · 143,084 words

Nomad Century: How Climate Migration Will Reshape Our World

by Gaia Vince  · 22 Aug 2022  · 302pp  · 92,206 words

Meditations for Mortals: Four Weeks to Embrace Your Limitations and Make Time for What Counts

by Oliver Burkeman  · 8 Oct 2024  · 123pp  · 43,370 words

Re-Educated: Why It’s Never Too Late to Change Your Life

by Lucy Kellaway  · 30 Jun 2021  · 184pp  · 60,229 words

The Measure of Progress: Counting What Really Matters

by Diane Coyle  · 15 Apr 2025  · 321pp  · 112,477 words

Women Talk Money: Breaking the Taboo

by Rebecca Walker  · 15 Mar 2022  · 322pp  · 106,663 words

Make Your Own Job: How the Entrepreneurial Work Ethic Exhausted America

by Erik Baker  · 13 Jan 2025  · 362pp  · 132,186 words

Secrets of the Sprakkar

by Eliza Reid  · 15 Jul 2021

Horizons: The Global Origins of Modern Science

by James Poskett  · 22 Mar 2022  · 564pp  · 168,696 words

Palo Alto: A History of California, Capitalism, and the World

by Malcolm Harris  · 14 Feb 2023  · 864pp  · 272,918 words

The Passenger

by AA.VV.  · 23 May 2022  · 192pp  · 59,615 words

Supertall: How the World's Tallest Buildings Are Reshaping Our Cities and Our Lives

by Stefan Al  · 11 Apr 2022  · 300pp  · 81,293 words

Making Sense of Chaos: A Better Economics for a Better World

by J. Doyne Farmer  · 24 Apr 2024  · 406pp  · 114,438 words

Win Every Argument: The Art of Debating, Persuading, and Public Speaking

by Mehdi Hasan  · 27 Feb 2023  · 307pp  · 93,073 words

The Last Ride of the Pony Express: My 2,000-Mile Horseback Journey Into the Old West

by Will Grant  · 14 Oct 2023  · 246pp  · 82,965 words

Material World: A Substantial Story of Our Past and Future

by Ed Conway  · 15 Jun 2023  · 515pp  · 152,128 words

The Rough Guide to Switzerland (Travel Guide eBook)

by Rough Guides  · 24 May 2022

Our Moon: How Earth's Celestial Companion Transformed the Planet, Guided Evolution, and Made Us Who We Are

by Rebecca Boyle  · 16 Jan 2024  · 354pp  · 109,574 words

Escape From Model Land: How Mathematical Models Can Lead Us Astray and What We Can Do About It

by Erica Thompson  · 6 Dec 2022  · 250pp  · 79,360 words

Drama Queen: One Autistic Woman and a Life of Unhelpful Labels

by Sara Gibbs  · 23 Jun 2021  · 263pp  · 89,341 words

Same as Ever: A Guide to What Never Changes

by Morgan Housel  · 7 Nov 2023  · 210pp  · 53,743 words

Secrets of the Autistic Millionaire: Everything I Know Now About Autism and Asperger's That I Wish I'd Known Then

by David William Plummer  · 14 Sep 2021

Bad Company

by Megan Greenwell  · 18 Apr 2025  · 385pp  · 103,818 words

Who Owns This Sentence?: A History of Copyrights and Wrongs

by David Bellos and Alexandre Montagu  · 23 Jan 2024  · 305pp  · 101,093 words

Billionaires' Row: Tycoons, High Rollers, and the Epic Race to Build the World's Most Exclusive Skyscrapers

by Katherine Clarke  · 13 Jun 2023  · 454pp  · 127,319 words

It's Not TV: The Spectacular Rise, Revolution, and Future of HBO

by Felix Gillette and John Koblin  · 1 Nov 2022  · 575pp  · 140,384 words

Slouching Towards Utopia: An Economic History of the Twentieth Century

by J. Bradford Delong  · 6 Apr 2020  · 593pp  · 183,240 words

The Internet Is Not What You Think It Is: A History, a Philosophy, a Warning

by Justin E. H. Smith  · 22 Mar 2022  · 198pp  · 59,351 words

There's Got to Be a Better Way

by Nelson P. Repenning and Donald C. Kieffer  · 26 Aug 2025  · 258pp  · 85,605 words

The Price of Time: The Real Story of Interest

by Edward Chancellor  · 15 Aug 2022  · 829pp  · 187,394 words

Eurowhiteness: Culture, Empire and Race in the European Project

by Hans Kundnani  · 16 Aug 2023  · 198pp  · 54,815 words

Blood in the Machine: The Origins of the Rebellion Against Big Tech

by Brian Merchant  · 25 Sep 2023  · 524pp  · 154,652 words

Shielded: How the Police Became Untouchable

by Joanna Schwartz  · 14 Feb 2023  · 422pp  · 114,817 words

Rough Sleepers: Dr. Jim O'Connell's Urgent Mission to Bring Healing to Homeless People

by Tracy Kidder  · 17 Jan 2023  · 270pp  · 88,213 words

House of Huawei: The Secret History of China's Most Powerful Company

by Eva Dou  · 14 Jan 2025  · 394pp  · 110,159 words

Heavy Metal: The Hard Days and Nights of the Shipyard Workers Who Build America's Supercarriers

by Michael Fabey  · 13 Jun 2022  · 319pp  · 102,839 words

Growth: From Microorganisms to Megacities

by Vaclav Smil  · 23 Sep 2019

How to Blow Up a Pipeline

by Andreas Malm  · 4 Jan 2021  · 156pp  · 49,653 words

Practical Anarchism: A Guide for Daily Life

by Scott. Branson  · 14 Jun 2022  · 198pp  · 63,612 words

Korea--Culture Smart!

by Culture Smart!  · 15 Jun 201  · 124pp  · 37,476 words

Apple in China: The Capture of the World's Greatest Company

by Patrick McGee  · 13 May 2025  · 377pp  · 138,306 words

Austin Like a Local

by DK  · 171pp  · 34,369 words

New York City Like a Local

by Dk Eyewitness  · 168pp  · 33,675 words

Barcelona Like a Local: by the People Who Call It Home

by Dk Eyewitness